휴먼 PDGF-B/PDGF-2 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag 태그

  • Human PDGF-B natural ORF mammalian expression plasmid, N-Flag tag
  • Human PDGF-B/PDGF-2 Gene Expression validated Image 16368
데이터시트리뷰관련제품프로토콜
휴먼 PDGFB cDNA 클론 제품 정보
Gene_bank_ref_id:NM_002608.2
cDNA 크기:726bp
cDNA 설명:Full length Clone DNA of Homo sapiens platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog) with N terminal Flag tag.
유전자 동의어:SIS, SSV, PDGF2, c-sis, FLJ12858
:Human
벡터:pCMV3-SP-N-FLAG
Plasmid:pCMV3-Flag-PDGFB
제한 사이트:KpnI + XbaI (6kb + 0.75kb)
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with PDGFB qPCR primers for gene expression analysis, HP100579 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
휴먼 PDGFB Gene Plasmid Map
Human PDGF-B natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

휴먼 PDGF-B/PDGF-2 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag 태그 on other vectors
Product nameProduct name
Size / Price
Cat No: HG10572-NF
정가: 
가격:      (You Save: )

Datasheet & Documentation

Contact Us
    최근에 조회한 품목
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".