After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 PDGFRA/CD140a Gene ORF cDNA clone expression plasmid, N-Flag 태그

데이터시트리뷰관련제품프로토콜
Human PDGFRA cDNA 클론 제품 정보
Gene_bank_ref_id:NM_006206.4
cDNA 크기:3270bp
cDNA 설명:Full length Clone DNA of Homo sapiens platelet-derived growth factor receptor, alpha polypeptide with N terminal Flag tag.
유전자 동의어:CD140A, PDGFR2, MGC74795, Rhe-PDGFRA
:Human
벡터:pCMV3-SP-N-FLAG
Plasmid:pCMV3-Flag-PDGFRA
제한 사이트:HindIII + NotI (6kb + 3.29kb)
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 534 C/T, 1719 A/G, 3240 T/C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Human PDGFRA Gene Plasmid Map
Human PDGFRα natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
연구배경

PDGFRA, also known as CD140a, together with the structurally homolog protein PDGFRB (CD140b), are cell surface receptors for members of the platelet-derived growth factor family. They are members of the class III subfamily of receptor tyrosine kinase (RTKs) with the similar structure characteristics of five immunoglobulin-like domains in their extracellular region and a split kinase domain in their intracellular region. PDGFRA is expressed in oligodendrocyte progenitor cells and mesothelial cell, and binds all three ligand isoforms PDGF-AA, PDGF-BB and PDGF-AB with high affinity, whereas PDGFRB dose not bind PDGF-AA. PDGFRA plays an essential role in regulating proliferation, chemotaxis and migration of mesangial cells. Recent studies have indicated that PDGFRA acts as a critical mediator of signaling in testis organogenesis and Leydig cell differentiation, and in addition, particularly important for kidney development. Additionally, PDGFRA is involved in tumor angiogenesis and maintenance of the tumor microenvironment and has been implicated in development and metastasis of Hepatocellular carcinoma (HCC). PDGFRA may represent a potential therapeutic target in thymic tumours. PDGFRA gene amplification rather than gene mutation may be the underlying genetic mechanism driving PDGFRA overexpression in a portion of gliomas.

참고자료
  • Oseini AM, et al. (2009) PDGFRalpha: a new therapeutic target in the treatment of hepatocellular carcinoma? Expert Opin Ther Targets. 13(4): 443-54.
  • Meister M, et al. (2009) Expression and mutational status of PDGFR in thymic tumours. Anticancer Res. 29(10): 4057-61.
  • Martinho O, et al. (2009) Expression, mutation and copy number analysis of platelet-derived growth factor receptor A (PDGFRA) and its ligand PDGFA in gliomas. Br J Cancer. 101(6): 973-82.
  • Size / Price
    Cat No: HG10556-NF
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보In Stock
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
    • Human PDGFRα natural ORF mammalian expression plasmid, N-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".