휴먼 PDK-1 Gene ORF cDNA clone expression plasmid, N-His 태그

데이터시트리뷰관련제품프로토콜
Human PDK1 cDNA 클론 제품 정보
Gene_bank_ref_id:BC039158
cDNA 크기:1311bp
cDNA 설명:Full length Clone DNA of Homo sapiens pyruvate dehydrogenase kinase, isozyme 1 with N terminal His tag.
유전자 동의어:PDK1
:Human
벡터:pCMV3-N-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
연구배경

Pyruvate dehydrogenase kinase, isozyme 1, also known as [Pyruvate dehydrogenase [lipoamide]] kinase isozyme 1, mitochondrial and PDK1, is a member of the PDK / BCKDK protein kinase family. PDK-1 is expressed predominantly in the heart. It contains one histidine kinase domain. Pyruvate dehydrogenase kinase (PDK) isoforms are molecular switches that downregulate the pyruvate dehydrogenase complex (PDC) by reversible phosphorylation in mitochondria. An inhibitory effect of lipoic acid on PDKs would result in less phosphorylation of E1 and hence increased PDC activity. At least two isoenzymic forms of pyruvate dehydrogenase kinase ( PDK-1 and PDK-2 ) may be involved in the regulation of enzymatic activity of mammalian pyruvate dehydrogenase complex by phosphorylation. PDK-3 appears to have the highest specific activity among the three isoenzymes. PDK-1 inhibits the mitochondrial pyruvate dehydrogenase complex by phosphorylation of the E1 alpha subunit, thus contributing to the regulation of glucose metabolism.

참고자료
  • Gudi R., et al., 1995, J. Biol. Chem. 270:28989-94.
  • Mooney,B.P. et al., 2000, Biochem Biophys Res Commun. 267 (2): 500 - 503.
  • Korotchkina,L.G. et al., 2004, Free Radic Res. 38 (10):1083-92.
  • Kato M., et al., 2007, Structure 15: 992-1004.
  • Size / Price
    Cat No: HG12312-NH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".