PDK2 cDNA ORF Clone, Human, N-His tag

Cat: HG12305-NH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All PDK2 Reagents

CRO Services

Product recommended


All PDK2 Reagents

PDK2 cDNA ORF Clone, Human, N-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1224 bp
Description
Full length Clone DNA of Human pyruvate dehydrogenase kinase, isozyme 2 with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PDK2 cDNA ORF Clone, Human, N-His tag Alternative Names

PDHK2 cDNA ORF Clone, Human;PDKII cDNA ORF Clone, Human

PDK2 Background Information

Full Name
pyruvate dehydrogenase kinase, isozyme 2

PDK2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PDK2 cDNA ORF Clone in Cloning Vector, Rat RG81589-G

PDK2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PDK2 cDNA ORF Clone in Cloning Vector, Mouse MG5A1559-U
PDK2 cDNA ORF Clone, Mouse, untagged MG5A1559-UT
PDK2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1559-ACG
PDK2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1559-ACGLN
PDK2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A1559-ANG
PDK2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A1559-ACR
PDK2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A1559-ANR
PDK2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A1559-CF
PDK2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A1559-NF
PDK2 cDNA ORF Clone, Mouse, C-His tag MG5A1559-CH
PDK2 cDNA ORF Clone, Mouse, N-His tag MG5A1559-NH
PDK2 cDNA ORF Clone, Mouse, C-HA tag MG5A1559-CY
PDK2 cDNA ORF Clone, Mouse, N-HA tag MG5A1559-NY
PDK2 cDNA ORF Clone, Mouse, C-Myc tag MG5A1559-CM
PDK2 cDNA ORF Clone, Mouse, N-Myc tag MG5A1559-NM

PDK2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PDK2 cDNA ORF Clone in Cloning Vector, Human HG12305-G
PDK2 cDNA ORF Clone, Human, untagged HG12305-UT
PDK2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12305-ACGLN
PDK2 cDNA ORF Clone, Human, C-GFPSpark® tag HG12305-ACG
PDK2 cDNA ORF Clone, Human, N-GFPSpark® tag HG12305-ANG
PDK2 cDNA ORF Clone, Human, C-OFPSpark® tag HG12305-ACR
PDK2 cDNA ORF Clone, Human, N-OFPSpark® tag HG12305-ANR
PDK2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12305-CF
PDK2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12305-NF
PDK2 cDNA ORF Clone, Human, C-His tag HG12305-CH
PDK2 cDNA ORF Clone, Human, C-HA tag HG12305-CY
PDK2 cDNA ORF Clone, Human, N-HA tag HG12305-NY
PDK2 cDNA ORF Clone, Human, C-Myc tag HG12305-CM
PDK2 cDNA ORF Clone, Human, N-Myc tag HG12305-NM
PDK2 qPCR Primer Pairs, Human HP101911
info info
添加购物车成功! 添加购物车失败!