휴먼 PDZD11/PDZK11 Gene ORF cDNA clone expression plasmid, C-Myc 태그

    데이터시트리뷰관련제품프로토콜
    휴먼 PDZD11 cDNA 클론 제품 정보
    Gene_bank_ref_id:BC012996
    cDNA 크기:423bp
    cDNA 설명:Full length Clone DNA of Homo sapiens PDZ domain containing 11 with C terminal Myc tag.
    유전자 동의어:PISP, AIPP1, PDZK11, PDZD11
    :Human
    벡터:pCMV3-C-Myc
    Plasmid:
    제한 사이트:
    태그 씨퀀스:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PDZD11 qPCR primers for gene expression analysis, HP101818 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    연구배경

    PDZ domain-containing protein 11, also known as AIPP1a, PISP, PDZD11 and PDZK11, is a cytosolic protein which contains one PDZ (DHR) domain. PDZD11 bears resemblance to members of the MALS / VELIS family of proteins. It contains but one PDZ domain that apparently interacts with the C-terminus of partner proteins. PDZD11 is ubiquitously expressed, and appears to target calcium and copper ATPases to basolateral cell membranes. PDZD11 is a transiently interacting partner of the PMCA b-splice forms that may play a role in their sorting to or from the plasma membrane. Full-length human PDZD11 shares 97% amino acids (aa) identity with mouse PDZD11.

    참고자료
  • Goellner,G.M. et al., 2003, Ann N Y Acad Sci. 986 :461-71.
  • Wolf-Yadlin A., et al., 2007, Proc. Natl. Acad. Sci. USA. 104:5860-5.
  • Heibeck T.H., et al.,2009, J. Proteome Res. 8:3852-61.
  • Size / Price
    Cat No: HG12188-CM
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".