PKC nu cDNA ORF Clone, Human, untagged

Cat: HG10665-UT

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All PKC nu Reagents

CRO Services

Product recommended


All PKC nu Reagents

PKC nu cDNA ORF Clone, Human, untagged General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
2673 bp
Description
Full length Clone DNA of Human protein kinase D3.

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PKC nu cDNA ORF Clone, Human, untagged Alternative Names

EPK2 cDNA ORF Clone, Human;nPKC-NU cDNA ORF Clone, Human;PKC-NU cDNA ORF Clone, Human;PKD3 cDNA ORF Clone, Human;PRKCN cDNA ORF Clone, Human

PKC nu Background Information

Serine/threonine-protein kinase D3, also known as Protein kinase C nu type, Protein kinase EPK2, PRKD3, EPK2 and PRKCN, is a cytoplasm and membrane protein which belongs to the protein kinase superfamily, CAMK Ser/Thr protein kinase family and PKD subfamily. PRKD3 / PRKCN contains one PH domain, two phorbol-ester/DAG-type zinc fingers and one protein kinase domain. Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. They also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role. PRKD3 / PRKCN converts transient diacylglycerol (DAG) signals into prolonged physiological effects, downstream of PKC. It is involved in resistance to oxidative stress. PRKD3 / PRKCN is activated by DAG and phorbol esters. Phorbol-ester/DAG-type domains 1 and 2 bind both DAG and phorbol ester with high affinity and mediate translocation to the cell membrane. Autophosphorylation of Ser-735 and phosphorylation of Ser-731 by PKC relieves auto-inhibition by the PH domain. PRKD3 / PRKCN can be activated rapidly by the agonists of G protein-coupled receptors. It resides in both cytoplasm and nucleus, and its nuclear accumulation is found to be dramatically enhanced in response to its activation. PRKD3 / PRKCN can also be activated after B-cell antigen receptor (BCR) engagement, which requires intact phospholipase C gamma and the involvement of other PKC family members.

Full Name
protein kinase D3
References
  • Schultz SJ, et al.,1994, Cell Growth Differ. 4 (10): 821-30.
  • Hayashi A, et al., 1999, Biochim Biophys Acta 1450 (1): 99-106.
  • Mayne M, et al., 2000, J. Immunol. 164 (12): 6538-42.
  • Ali A, et al., 2002, Chem. Rev. 101 (8): 2527-40.
  • PKC nu cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PKC nu cDNA ORF Clone in Cloning Vector, Mouse MG51080-G
    PKC nu cDNA ORF Clone, Mouse, untagged MG51080-UT
    PKC nu Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51080-ACGLN
    PKC nu cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51080-ACG
    PKC nu cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51080-ANG
    PKC nu cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51080-ACR
    PKC nu cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51080-ANR
    PKC nu cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51080-CF
    PKC nu cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51080-NF
    PKC nu cDNA ORF Clone, Mouse, C-His tag MG51080-CH
    PKC nu cDNA ORF Clone, Mouse, N-His tag MG51080-NH
    PKC nu cDNA ORF Clone, Mouse, C-HA tag MG51080-CY
    PKC nu cDNA ORF Clone, Mouse, N-HA tag MG51080-NY
    PKC nu cDNA ORF Clone, Mouse, C-Myc tag MG51080-CM
    PKC nu cDNA ORF Clone, Mouse, N-Myc tag MG51080-NM
    PKC nu qPCR Primer Pairs, Mouse MP201038

    PKC nu cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PKC nu cDNA ORF Clone in Cloning Vector, Human HG10665-M
    PKC nu Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10665-ACGLN
    PKC nu cDNA ORF Clone, Human, C-GFPSpark® tag HG10665-ACG
    PKC nu cDNA ORF Clone, Human, N-GFPSpark® tag HG10665-ANG
    PKC nu cDNA ORF Clone, Human, C-OFPSpark® tag HG10665-ACR
    PKC nu cDNA ORF Clone, Human, N-OFPSpark® tag HG10665-ANR
    PKC nu cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10665-CF
    PKC nu cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10665-NF
    PKC nu cDNA ORF Clone, Human, C-His tag HG10665-CH
    PKC nu cDNA ORF Clone, Human, N-His tag HG10665-NH
    PKC nu cDNA ORF Clone, Human, C-HA tag HG10665-CY
    PKC nu cDNA ORF Clone, Human, N-HA tag HG10665-NY
    PKC nu cDNA ORF Clone, Human, C-Myc tag HG10665-CM
    PKC nu cDNA ORF Clone, Human, N-Myc tag HG10665-NM
    PKC nu qPCR Primer Pairs, Human HP100874
    info info
    添加购物车成功! 添加购物车失败!