After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 PKM2 Gene ORF cDNA clone expression plasmid, N-Myc 태그

데이터시트리뷰관련제품프로토콜
Human PKM cDNA 클론 제품 정보
Gene_bank_ref_id:NM_002654.3
cDNA 크기:1596bp
cDNA 설명:Full length Clone DNA of Homo sapiens pyruvate kinase, muscle with N terminal Myc tag.
유전자 동의어:PK3, PKM, TCB, OIP3, CTHBP, THBP1, MGC3932, PKM2
:Human
벡터:pCMV3-N-Myc
Plasmid:pCMV3-Myc-PKM
제한 사이트:KpnI + NotI (6kb + 1.65kb)
태그 씨퀀스:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Human PKM Gene Plasmid Map
Human PKM2 natural ORF mammalian expression plasmid, N-Myc tag
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
연구배경

Pyruvate kinase isozymes M2 also known as pyruvate kinase muscle isozyme 2 (PKM2), pyruvate kinase type K, cytosolic thyroid hormone-binding protein (CTHBP), thyroid hormone-binding protein 1 (THBP1), or opa-interacting protein 3 (OIP3), is an isoenzyme of the glycolytic enzyme pyruvate kinase. Pyruvate kinase isozymes M2 / PKM2 is a protein involved in glycolysis. The encoded protein is a pyruvate kinase that catalyzes the transfer of a phosphoryl group from phosphoenolpyruvate to ADP, generating ATP and pyruvate. PKM2 has been shown to interact with thyroid hormone and may mediate cellular metabolic effects induced by thyroid hormones. PKM2 has been found to bind Opa protein, a bacterial outer membrane protein involved in gonococcal adherence to and invasion of human cells, suggesting a role of this protein in bacterial pathogenesis. Several alternatively spliced transcript variants encoding a few distinct isoforms have been reported. PKM2 functions as a glycolytic enzyme that catalyzes the transfer of a phosphoryl group from phosphoenolpyruvate (PEP) to ADP, generating ATP. PKM2 may stimulates POU5F1-mediated transcriptional activation. This protein Plays a general role in caspase independent cell death of tumor cells. The ratio betwween the highly active tetrameric form and nearly inactive dimeric form determines whether glucose carbons are channeled to biosynthetic processes or used for glycolytic ATP production. The transition between the 2 forms of PKM2 contributes to the control of glycolysis and is important for tumor cell proliferation and survival.

참고자료
  • Bluemlein K, et al. (2011) No evidence for a shift in pyruvate kinase PKM1 to PKM2 expression during tumorigenesis. Oncotarget. 2 (5): 393-400.
  • Gupta V, et al. (2010) Dominant Negative Mutations Affect Oligomerization of Human Pyruvate Kinase M2 Isozyme and Promote Cellular Growth and Polyploidy. J Biol Chem. 285 (22): 16864-73.
  • Eigenbrodt E, et al. (1992) Double role for pyruvate kinase type M2 in the expansion of phosphometabolite pools found in tumor cells. Crit Rev Oncog. 3 (1): 91-115.
  • Size / Price
    Cat No: HG11430-NM
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보In Stock
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
    • Human PKM2 natural ORF mammalian expression plasmid, N-Myc tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".