Text Size:AAA

휴먼 PLAC9 / placenta-specific 9 Gene ORF cDNA clone expression plasmid, N-Flag 태그

    데이터시트리뷰관련제품프로토콜
    휴먼 PLAC9 cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_001012973.1
    cDNA 크기:294bp
    cDNA 설명:Full length Clone DNA of Homo sapiens placenta-specific 9 with N terminal Flag tag.
    유전자 동의어:PLAC9
    :Human
    벡터:pCMV3-SP-N-FLAG
    Plasmid:
    제한 사이트:
    태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PLAC9 qPCR primers for gene expression analysis, HP102628 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Product nameProduct name
    연구배경

    PLAC9 belongs to the PLAC9 family. PLAC9 gene is a placental-enriched gene. There are other two placental-enriched genes: Plac1 and Plac8. Plac1 is strongly expressed in all trophoblast-derived cells in the placenta and has been described in 2000. Plac8 expression is restricted to the spongiotrophoblast layer during development, whereas PLAC9 is weakly expressed though highly enriched in placenta. For both, cDNAs with complete open reading frames were recovered and exon-intron structures inferred from comparisons of mouse cDNA and genomic sequence. The predicted proteins both contain putative signal peptides, with a coiled-coil segment of mPLAC9 as the only other detected motif. Genomic sequence comparisons reveal that in addition to an apparent pseudogene on chromosome 1, Plac8 is expressed at mouse cytoband 5e3.

    참고자료
  • Deloukas P. et al., 2004, Nature. 429 (6990): 375-81.
  • Galaviz-Hernandez C. et al., 2003, Gene. 309 (2): 81-9.
  • Gerhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".