PLK2 cDNA ORF Clone, Human, N-His tag

Cat: HG11374-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PLK2 Reagents
CRO Services
Product recommended

All PLK2 Reagents
PLK2 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2058 bp
Description
Full length Clone DNA of Human polo-like kinase 2 (Drosophila) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PLK2 cDNA ORF Clone, Human, N-His tag Alternative Names
hPlk2 cDNA ORF Clone, Human;hSNK cDNA ORF Clone, Human;SNK cDNA ORF Clone, Human
PLK2 Background Information
Full Name
polo like kinase 2

PLK2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PLK2 cDNA ORF Clone in Cloning Vector, Mouse MG5A0771-U
PLK2 cDNA ORF Clone, Mouse, untagged MG5A0771-UT
PLK2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0771-ACG
PLK2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0771-ACGLN
PLK2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A0771-ANG
PLK2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A0771-ACR
PLK2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A0771-ANR
PLK2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A0771-CF
PLK2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A0771-NF
PLK2 cDNA ORF Clone, Mouse, C-His tag MG5A0771-CH
PLK2 cDNA ORF Clone, Mouse, N-His tag MG5A0771-NH
PLK2 cDNA ORF Clone, Mouse, C-HA tag MG5A0771-CY
PLK2 cDNA ORF Clone, Mouse, N-HA tag MG5A0771-NY
PLK2 cDNA ORF Clone, Mouse, C-Myc tag MG5A0771-CM
PLK2 cDNA ORF Clone, Mouse, N-Myc tag MG5A0771-NM

PLK2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PLK2 cDNA ORF Clone in Cloning Vector, Human HG11374-M
PLK2 cDNA ORF Clone, Human, untagged HG11374-UT
PLK2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11374-ACG
PLK2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11374-ACGLN
PLK2 cDNA ORF Clone, Human, N-GFPSpark® tag HG11374-ANG
PLK2 cDNA ORF Clone, Human, C-OFPSpark® tag HG11374-ACR
PLK2 cDNA ORF Clone, Human, N-OFPSpark® tag HG11374-ANR
PLK2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11374-CF
PLK2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11374-NF
PLK2 cDNA ORF Clone, Human, C-His tag HG11374-CH
PLK2 cDNA ORF Clone, Human, C-HA tag HG11374-CY
PLK2 cDNA ORF Clone, Human, N-HA tag HG11374-NY
PLK2 cDNA ORF Clone, Human, C-Myc tag HG11374-CM
PLK2 cDNA ORF Clone, Human, N-Myc tag HG11374-NM
PLK2 qPCR Primer Pairs, Human HP101256
info info
添加购物车成功! 添加购物车失败!