After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 phosphomannomutase 2 / PMM2 / CDG1 Gene ORF cDNA clone expression plasmid, N-HA 태그

데이터시트리뷰관련제품프로토콜
Human PMM2 cDNA 클론 제품 정보
Gene_bank_ref_id:BC008310
cDNA 크기:741bp
cDNA 설명:Full length Clone DNA of Homo sapiens phosphomannomutase 2 with N terminal HA tag.
유전자 동의어:PMI, CDG1, CDGS, PMI1, CDG1a, PMM 2
:Human
벡터:pCMV3-N-HA
Plasmid:
제한 사이트:
태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

휴먼 phosphomannomutase 2 / PMM2 / CDG1 Gene ORF cDNA clone expression plasmid, N-HA 태그 on other vectors
휴먼 phosphomannomutase 2 / PMM2 / CDG1 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG14648-ACG265260
휴먼 phosphomannomutase 2 / PMM2 / CDG1 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG14648-ACR265260
휴먼 phosphomannomutase 2 / PMM2 / CDG1 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG14648-ANG265260
휴먼 phosphomannomutase 2 / PMM2 / CDG1 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG14648-ANR265260
휴먼 phosphomannomutase 2 / PMM2 / CDG1 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG14648-CF229890
휴먼 phosphomannomutase 2 / PMM2 / CDG1 Gene ORF cDNA clone expression plasmid, C-His 태그HG14648-CH229890
휴먼 phosphomannomutase 2 / PMM2 / CDG1 Gene ORF cDNA clone expression plasmid, C-Myc 태그HG14648-CM229890
휴먼 phosphomannomutase 2 / PMM2 / CDG1 Gene ORF cDNA clone expression plasmid, C-HA 태그HG14648-CY229890
휴먼 phosphomannomutase 2 / PMM2 / CDG1 Gene ORF cDNA clone in cloning vectorHG14648-G88420
휴먼 phosphomannomutase 2 / PMM2 / CDG1 Gene ORF cDNA clone expression plasmid, N-Flag 태그HG14648-NF229890
휴먼 phosphomannomutase 2 / PMM2 / CDG1 Gene ORF cDNA clone expression plasmid, N-His 태그HG14648-NH229890
휴먼 phosphomannomutase 2 / PMM2 / CDG1 Gene ORF cDNA clone expression plasmid, N-Myc 태그HG14648-NM229890
휴먼 phosphomannomutase 2 / PMM2 / CDG1 Gene ORF cDNA clone expression plasmid, N-HA 태그HG14648-NY229890
휴먼 phosphomannomutase 2 / PMM2 / CDG1 Gene ORF cDNA clone expression plasmidHG14648-UT229890
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

Phosphomannomutase 2, also known as PMM2 and CDG1, belongs to the eukaryotic PMM family. Phosphomannomutase 2 catalyzes the isomerization of mannose 6-phosphate to mannose 1-phosphate. Mannose 1-phosphate is a precursor to GDP-mannose necessary for the synthesis of dolichol-P-oligosaccharides. GDP-mannose can transfer its small sugar molecule called mannose to the growing oligosaccharide chain. Once the correct number of small sugar molecules are linked together to form the oligosaccharide, it can be attached to a protein. Phosphomannomutase 2 is also required for a number of critical mannosyl transfer reactions. Mutations in PMM2 gene have been shown to cause defects in the protein glycosylation pathway manifest as carbohydrate-deficient glycoprotein syndrome type I.

참고자료
  • Jaeken J. et al., 2002, Annual review of genomics and human genetics. 2: 129-51.
  • Matthijs G. et al., 2000, Mol Genet Metab. 68 (2): 220-6.
  • Matthijs G. et al., 1997, Nat Genet. 16 (1): 88-92.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".