After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 Galactolipase / PNLIPRP2 Gene ORF cDNA clone expression plasmid, N-His 태그

데이터시트리뷰관련제품프로토콜
Human PNLIPRP2 cDNA 클론 제품 정보
Gene_bank_ref_id:BC005989
cDNA 크기:1410bp
cDNA 설명:Full length Clone DNA of Homo sapiens pancreatic lipase-related protein 2 with N terminal His tag.
유전자 동의어:PLRP2
:Human
벡터:pCMV3-SP-N-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
연구배경

Galactolipase, also known as PNLIPRP2, is a lipase with broad substrate specificity. It can hydrolyze both phospholipids and galactolipids. Galactolipase acts preferentially on monoglycerides, phospholipids and galactolipids. It also hydrolyses milk fat with a lower catalytic efficiency. The expressed galactolipase shows a lipolytic activity that is, however, only marginally dependent on the presence of colipase. The lipolytic activity of pancreatic extracts and human pancreatic juice on Labrasol is mainly due to the combined action of carboxyl ester hydrolase and galactolipase.

참고자료
  • Andersson EL, et al. (2011) BSSL and PLRP2: key enzymes for lipid digestion in the newborn examined using the Caco-2 cell line. J Lipid Res. 52(11):1949-56.
  • Xiao X, et al. (2011) Pancreatic lipase-related protein-2 (PLRP2) can contribute to dietary fat digestion in human newborns. J Biol Chem. 286(30):26353-63.
  • Alves BN, et al. (2009) Lipid-dependent cytotoxicity by the lipase PLRP2 and by PLRP2-positive cytotoxic T lymphocytes (CTLs). Cell Biochem Funct. 27(5):296-308.
  • Size / Price
    Cat No: HG13687-NH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".