After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 PPARG Gene ORF cDNA clone expression plasmid

데이터시트리뷰관련제품프로토콜
Human PPARG cDNA 클론 제품 정보
Gene_bank_ref_id:NM_015869.4
cDNA 크기:1518bp
cDNA 설명:Full length Clone DNA of Homo sapiens peroxisome proliferator-activated receptor gamma.
유전자 동의어:PPARG1, PPARG2, NR1C3, PPARgamma
:Human
벡터:pCMV3-untagged
Plasmid:pCMV3-PPARG
제한 사이트:KpnI + XbaI (6.1kb + 1.52kb)
태그 씨퀀스:
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Human PPARG Gene Plasmid Map
Human PPARG Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
참고자료
  • Hamblin M, et al. (2009) PPARs and the Cardiovascular System. Antioxid Redox Signal. 11 (6): 1415-52.
  • Khateeb J, et al. (2010) Paraoxonase 1 (PON1) expression in hepatocytes is upregulated by pomegranate polyphenols: a role for PPAR-gamma pathway. Atherosclerosis. 208 (1): 119-25.
  • Fajas L, et al. (1997) The organization, promoter analysis, and expression of the human PPARgamma gene. J Biol Chem. 272 (30): 18779-89.
  • Size / Price
    Cat No: HG12019-UT
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보In Stock
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
    • Human PPARG Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".