PPAR gamma cDNA ORF Clone, Human, untagged

Cat: HG12019-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PPAR gamma Reagents
CRO Services
Product recommended

All PPAR gamma Reagents
PPAR gamma cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1518 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human peroxisome proliferator-activated receptor gamma.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI + XbaI (6.1kb + 1.52kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
PPAR gamma cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PPAR gamma cDNA ORF Clone, Human, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5613
PPAR gamma cDNA ORF Clone, Human, untagged Alternative Names
CIMT1 cDNA ORF Clone, Human;GLM1 cDNA ORF Clone, Human;NR1C3 cDNA ORF Clone, Human;PPARG1 cDNA ORF Clone, Human;PPARG2 cDNA ORF Clone, Human;PPARgamma cDNA ORF Clone, Human
PPAR gamma Background Information
Full Name
peroxisome proliferator-activated receptor gamma
References
  • Hamblin M, et al. (2009) PPARs and the Cardiovascular System. Antioxid Redox Signal. 11 (6): 1415-52.
  • Khateeb J, et al. (2010) Paraoxonase 1 (PON1) expression in hepatocytes is upregulated by pomegranate polyphenols: a role for PPAR-gamma pathway. Atherosclerosis. 208 (1): 119-25.
  • Fajas L, et al. (1997) The organization, promoter analysis, and expression of the human PPARgamma gene. J Biol Chem. 272 (30): 18779-89.
  • PPAR gamma cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    PPAR gamma cDNA ORF Clone in Cloning Vector, Rat RG80954-U
    PPAR gamma cDNA ORF Clone, Rat, untagged RG80954-UT
    PPAR gamma Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80954-ACGLN
    PPAR gamma cDNA ORF Clone, Rat, C-GFPSpark® tag RG80954-ACG
    PPAR gamma cDNA ORF Clone, Rat, N-GFPSpark® tag RG80954-ANG
    PPAR gamma cDNA ORF Clone, Rat, C-OFPSpark® tag RG80954-ACR
    PPAR gamma cDNA ORF Clone, Rat, N-OFPSpark® tag RG80954-ANR
    PPAR gamma cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80954-CF
    PPAR gamma cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80954-NF
    PPAR gamma cDNA ORF Clone, Rat, C-His tag RG80954-CH
    PPAR gamma cDNA ORF Clone, Rat, N-His tag RG80954-NH
    PPAR gamma cDNA ORF Clone, Rat, C-HA tag RG80954-CY
    PPAR gamma cDNA ORF Clone, Rat, N-HA tag RG80954-NY
    PPAR gamma cDNA ORF Clone, Rat, C-Myc tag RG80954-CM
    PPAR gamma cDNA ORF Clone, Rat, N-Myc tag RG80954-NM
    PPAR gamma qPCR Primer Pairs, Rat RP300918

    PPAR gamma cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PPAR gamma cDNA ORF Clone in Cloning Vector, Mouse MG53363-U
    PPAR gamma cDNA ORF Clone, Mouse, untagged MG53363-UT
    PPAR gamma cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53363-ACG
    PPAR gamma Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53363-ACGLN
    PPAR gamma cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53363-ANG
    PPAR gamma cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53363-ACR
    PPAR gamma cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53363-ANR
    PPAR gamma cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53363-CF
    PPAR gamma cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53363-NF
    PPAR gamma cDNA ORF Clone, Mouse, C-His tag MG53363-CH
    PPAR gamma cDNA ORF Clone, Mouse, N-His tag MG53363-NH
    PPAR gamma cDNA ORF Clone, Mouse, C-HA tag MG53363-CY
    PPAR gamma cDNA ORF Clone, Mouse, N-HA tag MG53363-NY
    PPAR gamma cDNA ORF Clone, Mouse, C-Myc tag MG53363-CM
    PPAR gamma cDNA ORF Clone, Mouse, N-Myc tag MG53363-NM

    PPAR gamma cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PPAR gamma cDNA ORF Clone in Cloning Vector, Human HG12019-G
    PPAR gamma Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12019-ACGLN
    PPAR gamma cDNA ORF Clone, Human, C-GFPSpark® tag HG12019-ACG
    PPAR gamma cDNA ORF Clone, Human, N-GFPSpark® tag HG12019-ANG
    PPAR gamma cDNA ORF Clone, Human, C-OFPSpark® tag HG12019-ACR
    PPAR gamma cDNA ORF Clone, Human, N-OFPSpark® tag HG12019-ANR
    PPAR gamma cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12019-CF
    PPAR gamma cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12019-NF
    PPAR gamma cDNA ORF Clone, Human, C-His tag HG12019-CH
    PPAR gamma cDNA ORF Clone, Human, N-His tag HG12019-NH
    PPAR gamma cDNA ORF Clone, Human, C-HA tag HG12019-CY
    PPAR gamma cDNA ORF Clone, Human, N-HA tag HG12019-NY
    PPAR gamma cDNA ORF Clone, Human, C-Myc tag HG12019-CM
    PPAR gamma cDNA ORF Clone, Human, N-Myc tag HG12019-NM
    PPAR gamma qPCR Primer Pairs, Human HP101555
    info info
    添加购物车成功! 添加购物车失败!