After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

휴먼 PPP3CA transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His 태그

데이터시트리뷰관련제품프로토콜
Human PPP3CA cDNA 클론 제품 정보
Gene_bank_ref_id:NM_000944.4
cDNA 크기:1566bp
cDNA 설명:Full length Clone DNA of Homo sapiens protein phosphatase 3, catalytic subunit, alpha isozyme, transcript variant 1 with N terminal His tag.
유전자 동의어:CALN, CCN1, CNA1, CALNA, PPP2B, CALNA1, PPP3CA
:Human
벡터:pCMV3-N-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

휴먼 PPP3CA transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His 태그 on other vectors
휴먼 PPP3CA transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG13670-ACG288840
휴먼 PPP3CA transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG13670-ACR288840
휴먼 PPP3CA transcript variant 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG13670-ANG288840
휴먼 PPP3CA transcript variant 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG13670-ANR288840
휴먼 PPP3CA transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG13670-CF253470
휴먼 PPP3CA transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His 태그HG13670-CH253470
휴먼 PPP3CA transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc 태그HG13670-CM253470
휴먼 PPP3CA transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA 태그HG13670-CY253470
휴먼 PPP3CA transcript variant 1 Gene ORF cDNA clone in cloning vectorHG13670-G88420
휴먼 PPP3CA transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag 태그HG13670-NF253470
휴먼 PPP3CA transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His 태그HG13670-NH253470
휴먼 PPP3CA transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc 태그HG13670-NM253470
휴먼 PPP3CA transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA 태그HG13670-NY253470
휴먼 PPP3CA transcript variant 1 Gene ORF cDNA clone expression plasmidHG13670-UT253470
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

PPP3CA, also known as protein phosphatase 2B, is a member of the PPP phosphatase family, PP-2B subfamily. It is the alpha catalytic subunit of protein phosphatase 2B (PP2B). PP2B is a holoenzyme that is comprised of a catalytic subunit associated with regulatory subunits. It is a calcium regulated enzyme that is activated by calmodulin and participates in the signaling cascades involved in development of the nervous, cardiovascular, and musculoskeletal systems. PPP3CA activates the T cells of the immune system and can be blocked by drugs. It also activates NFATc (a transcription factor) by dephosphorylating it. The activated NFATc is subsequently translocated into the nucleus, where it upregulates the expression of interleukin 2. PPP3CA interacts with CRTC2, MYOZ1, MYOZ2 and MYOZ3. It also interacts with DNM1L. The interaction dephosphorylates DNM1L and regulates its translocation to mitochondria.

참고자료
  • Frey N, et al. (2002) Calsarcin-3, a Novel Skeletal Muscle-specific Member of the Calsarcin Family, Interacts with Multiple Z-disc Proteins. Journal of Biological Chemistry. 277(16): 13998-4004.
  • Frey N, et al. (2000) Calsarcins, a novel family of sarcomeric calcineurin-binding proteins. Proceedings of the National Academy of Sciences. 97(26):14632-7.
  • Crabtree G R, et al. (1999) Generic signals and specific outcomes: Signaling through Ca2+, calcineurin, and NF-AT. Cell. 96(5):611-4.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".