휴먼 PPP3CA transcript variant 2 Gene ORF cDNA clone expression plasmid, N-His 태그

데이터시트리뷰관련제품프로토콜
Human PPP3CA cDNA 클론 제품 정보
Gene_bank_ref_id:NM_001130691.1
cDNA 크기:1536bp
cDNA 설명:Full length Clone DNA of Homo sapiens protein phosphatase 3, catalytic subunit, alpha isozyme, transcript variant 2 with N terminal His tag.
유전자 동의어:CALN, CCN1, CNA1, CALNA, PPP2B, CALNA1, PPP3CA
:Human
벡터:pCMV3-N-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

휴먼 PPP3CA transcript variant 2 Gene ORF cDNA clone expression plasmid, N-His 태그 on other vectors
휴먼 PPP3CA transcript variant 2 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG13669-ACG288840
휴먼 PPP3CA transcript variant 2 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG13669-ACR288840
휴먼 PPP3CA transcript variant 2 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG13669-ANG288840
휴먼 PPP3CA transcript variant 2 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG13669-ANR288840
휴먼 PPP3CA transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG13669-CF253472
휴먼 PPP3CA transcript variant 2 Gene ORF cDNA clone expression plasmid, C-His 태그HG13669-CH253472
휴먼 PPP3CA transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Myc 태그HG13669-CM253472
휴먼 PPP3CA transcript variant 2 Gene ORF cDNA clone expression plasmid, C-HA 태그HG13669-CY253472
휴먼 PPP3CA transcript variant 2 Gene ORF cDNA clone in cloning vectorHG13669-G88421
휴먼 PPP3CA transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Flag 태그HG13669-NF253472
휴먼 PPP3CA transcript variant 2 Gene ORF cDNA clone expression plasmid, N-His 태그HG13669-NH253472
휴먼 PPP3CA transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Myc 태그HG13669-NM253472
휴먼 PPP3CA transcript variant 2 Gene ORF cDNA clone expression plasmid, N-HA 태그HG13669-NY253472
휴먼 PPP3CA transcript variant 2 Gene ORF cDNA clone expression plasmidHG13669-UT253472
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

PPP3CA, also known as protein phosphatase 2B, is a member of the PPP phosphatase family, PP-2B subfamily. It is the alpha catalytic subunit of protein phosphatase 2B (PP2B). PP2B is a holoenzyme that is comprised of a catalytic subunit associated with regulatory subunits. It is a calcium regulated enzyme that is activated by calmodulin and participates in the signaling cascades involved in development of the nervous, cardiovascular, and musculoskeletal systems. PPP3CA activates the T cells of the immune system and can be blocked by drugs. It also activates NFATc (a transcription factor) by dephosphorylating it. The activated NFATc is subsequently translocated into the nucleus, where it upregulates the expression of interleukin 2. PPP3CA interacts with CRTC2, MYOZ1, MYOZ2 and MYOZ3. It also interacts with DNM1L. The interaction dephosphorylates DNM1L and regulates its translocation to mitochondria.

참고자료
  • Frey N, et al. (2002) Calsarcin-3, a Novel Skeletal Muscle-specific Member of the Calsarcin Family, Interacts with Multiple Z-disc Proteins. Journal of Biological Chemistry. 277(16): 13998-4004.
  • Frey N, et al. (2000) Calsarcins, a novel family of sarcomeric calcineurin-binding proteins. Proceedings of the National Academy of Sciences. 97(26):14632-7.
  • Crabtree G R, et al. (1999) Generic signals and specific outcomes: Signaling through Ca2+, calcineurin, and NF-AT. Cell. 96(5):611-4.
  • Size / Price
    Cat No: HG13669-NH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".