After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 PPP3R1 Gene ORF cDNA clone expression plasmid, N-His 태그

데이터시트리뷰관련제품프로토콜
Human PPP3R1 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_000945.3
cDNA 크기:513bp
cDNA 설명:Full length Clone DNA of Homo sapiens protein phosphatase 3, regulatory subunit B, alpha with N terminal His tag.
유전자 동의어:CNB, CNB1, CALNB1, PPP3R1
:Human
벡터:pCMV3-N-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
연구배경

PPP3R1 belongs to the calcineurin regulatory subunit family. It is a regulatory subunit of calcineurin. Calcineurin is composed of two subunits: calcineurin A (CnA) and calcineurin B (CnB). Dephosphorylation of the nuclear factor of activated T-cells (NF-AT) by Calcineurin is essential for NF-AT activation, nuclear translocation, and early gene expression in T-cells. PPP3R1 is a Ser/Thr-specific calcium and calmodulin-dependent protein phosphatase which takes a vital part in the T cell activation pathway. PPP3R1 is involved in protein dephosphorylation, NFAT protein import into nucleus (ortholog) and epithelial to mesenchymal transition (ortholog). It participates in calcineurin signaling pathway; mitogen activated protein kinase signaling pathway. PPP3R1 interacts with (+)-pilocarpine, 2,4-dinitrotoluene and ammonium chloride. It contains four EF-hand domains and four functional calcium-binding sites. PPP3R1 play an improtant role in the T cell activation pathway.

참고자료
  • Feng B, et al. (1999) Interactions of calcineurin A, calcineurin B, and Ca2+. Biochemistry 38 (38): 12481-9.
  • Kawamura A, et al. (1995) Interaction of FKBP12-FK506 with calcineurin A at the B subunit-binding domain. J Biol Chem. 270(26):15463-6.
  • Wang MG, et al. (1997) Calcineurin A alpha (PPP3CA), calcineurin A beta (PPP3CB) and calcineurin B (PPP3R1) are located on human chromosomes 4, 10q21q22 and 2p16p15 respectively. Cytogenet Cell Genet. 72(2-3):236-41.
  • Size / Price
    Cat No: HG13673-NH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".