After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

휴먼 Peroxiredoxin 1/PRDX1 Gene ORF cDNA clone expression plasmid

데이터시트리뷰관련제품프로토콜
Human PRDX1 cDNA 클론 제품 정보
Gene_bank_ref_id:BC007063.1
cDNA 크기:600bp
cDNA 설명:Full length Clone DNA of Homo sapiens peroxiredoxin 1.
유전자 동의어:PAG, PAGA, PAGB, PRX1, PRXI, MSP23, NKEFA, TDPX2, PRDX1
:Human
벡터:pCMV3-untagged
Plasmid:pCMV3-PRDX1
제한 사이트:KpnI + XbaI (6.1kb + 0.6kb)
태그 씨퀀스:
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Human PRDX1 Gene Plasmid Map
Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
휴먼 Peroxiredoxin 1/PRDX1 Gene ORF cDNA clone expression plasmid on other vectors
휴먼 Peroxiredoxin 1/PRDX1 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG11194-ACG265260
휴먼 Peroxiredoxin 1/PRDX1 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG11194-ACR265260
휴먼 Peroxiredoxin 1/PRDX1 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG11194-ANG265260
휴먼 Peroxiredoxin 1/PRDX1 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG11194-ANR265260
휴먼 Peroxiredoxin 1/PRDX1 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG11194-CF229890
휴먼 Peroxiredoxin 1/PRDX1 Gene ORF cDNA clone expression plasmid, C-His 태그HG11194-CH229890
휴먼 Peroxiredoxin 1/PRDX1 Gene ORF cDNA clone expression plasmid, C-Myc 태그HG11194-CM229890
휴먼 Peroxiredoxin 1/PRDX1 Gene ORF cDNA clone expression plasmid, C-HA 태그HG11194-CY229890
휴먼 Peroxiredoxin 1/PRDX1 Gene ORF cDNA clone in cloning vectorHG11194-M88420
휴먼 Peroxiredoxin 1/PRDX1 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG11194-M-F229890
휴먼 Peroxiredoxin 1/PRDX1 Gene ORF cDNA clone expression plasmid, N-Flag 태그HG11194-NF229890
휴먼 Peroxiredoxin 1/PRDX1 Gene ORF cDNA clone expression plasmid, N-His 태그HG11194-NH229890
휴먼 Peroxiredoxin 1/PRDX1 Gene ORF cDNA clone expression plasmid, N-Myc 태그HG11194-NM229890
휴먼 Peroxiredoxin 1/PRDX1 Gene ORF cDNA clone expression plasmid, N-HA 태그HG11194-NY229890
휴먼 Peroxiredoxin 1/PRDX1 Gene ORF cDNA clone expression plasmidHG11194-UT229890
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

Peroxiredoxin-1, also known as Thioredoxin peroxidase 2, Natural killer cell-enhancing factor A, PRDX1, and PAGA, is a member of the ahpC/TSA family. Peroxiredoxin-1 is constitutively expressed in most human cells. It is induced to higher levels upon serum stimulation in untransformed and transformed cells. Peroxiredoxins (PRDXs) are a family of antioxidant enzymes that are also known as scavengers of peroxide in mammalian cells. The overexpression of Peroxiredoxin-1, which is one of the peroxiredoxins that is a ubiquitously expressed protein, was related to a poor prognosis in several types of human cancers. Peroxiredoxin-1 is involved in redox regulation of the cell. It reduces peroxides with reducing equivalents provided through the thioredoxin system but not from glutaredoxin and may play an important role in eliminating peroxides generated during metabolism. Peroxiredoxin-1 Might participate in the signaling cascades of growth factors and tumor necrosis factor-alpha by regulating the intracellular concentrations of H2O2. The reduced Peroxiredoxin-1 expression is an important factor in esophageal squamous cancer progression and could serve as a useful prognostic marker.

참고자료
  • Neumann, CA. et al., 2003, Nature 424 (6948): 561-5
  • Gisin, J. et al., 2005, J Clin Pathol. 58 (11): 1229-31.
  • Hoshino, I. et al., 2007, Oncol Rep. 18 (4): 867-71.
  • Cao, J. et al., 2009, EMBO J. 28 (10): 1505-17.
  • Size / Price
    Cat No: HG11194-UT
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보In Stock
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
    • Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".