After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 Prolyl endopeptidase / PREP Gene ORF cDNA clone expression plasmid, C-Flag 태그

데이터시트리뷰관련제품프로토콜
Human PREP cDNA 클론 제품 정보
Gene_bank_ref_id:NM_002726.3
cDNA 크기:2133bp
cDNA 설명:Full length Clone DNA of Homo sapiens prolyl endopeptidase with C terminal Flag tag.
유전자 동의어:PE, PEP, MGC16060
:Human
벡터:pCMV3-C-FLAG
Plasmid:
제한 사이트:
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

휴먼 Prolyl endopeptidase / PREP Gene ORF cDNA clone expression plasmid, C-Flag 태그 on other vectors
휴먼 Prolyl endopeptidase / PREP Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG10987-ACG288840
휴먼 Prolyl endopeptidase / PREP Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG10987-ACR288840
휴먼 Prolyl endopeptidase / PREP Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG10987-ANG288840
휴먼 Prolyl endopeptidase / PREP Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG10987-ANR288840
휴먼 Prolyl endopeptidase / PREP Gene ORF cDNA clone expression plasmid, C-Flag 태그HG10987-CF253470
휴먼 Prolyl endopeptidase / PREP Gene ORF cDNA clone expression plasmid, C-His 태그HG10987-CH253470
휴먼 Prolyl endopeptidase / PREP Gene ORF cDNA clone expression plasmid, C-Myc 태그HG10987-CM253470
휴먼 Prolyl endopeptidase / PREP Gene ORF cDNA clone expression plasmid, C-HA 태그HG10987-CY253470
휴먼 Prolyl endopeptidase / PREP Gene ORF cDNA clone in cloning vectorHG10987-M88420
휴먼 Prolyl endopeptidase / PREP Gene ORF cDNA clone expression plasmid, N-Flag 태그HG10987-NF253470
휴먼 Prolyl endopeptidase / PREP Gene ORF cDNA clone expression plasmid, N-His 태그HG10987-NH253470
휴먼 Prolyl endopeptidase / PREP Gene ORF cDNA clone expression plasmid, N-Myc 태그HG10987-NM253470
휴먼 Prolyl endopeptidase / PREP Gene ORF cDNA clone expression plasmid, N-HA 태그HG10987-NY253470
휴먼 Prolyl endopeptidase / PREP Gene ORF cDNA clone expression plasmidHG10987-UT253470
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

Prolyl endopeptidase, also known as PREP, belongs to a distinct class of serine peptidases. It is a large cytosolic enzyme which was first described in the cytosol of rabbit brain as an oligopeptidase. Prolyl endopeptidase degrades the nonapeptide bradykinin at the Pro-Phe bond. It is involved in the maturation and degradation of peptide hormones and neuropeptides such as alpha-melanocyte-stimulating hormone, luteinizing hormone-releasing hormone (LH-RH), thyrotropin-releasing hormone, angiotensin, neurotensin, oxytocin, substance P and vasopressin. Prolyl endopeptidase's activity is confined to action on oligopeptides of less than 10 kD and it has an absolute requirement for the trans-configuration of the peptide bond preceding proline. It cleaves peptide bonds at the C-terminal side of proline residues.

참고자료
  • Oliveira EB, et al. (1976) Isolation of brain endopeptidases: Influence of size and sequence of substrates structurally related to bradykinin. Biochemistry. 15(9):1967-74.
  • Stepniak D, et al. (2006) Highly efficient gluten degradation with a newly identified prolyl endoprotease: implications for celiac disease. Am J Physiol Gastrointest Liver Physiol. 291(4): G621-9.
  • Jarho EM, et al. (2007) 2(S)-(Cycloalk-1-enecarbonyl)-1-(4-phenyl-butanoyl)pyrrolidines and 2(S)-(aroyl)-1-(4-phenylbutanoyl)pyrrolidines as prolyl oligopeptidase inhibitors. Bioorg Med Chem. 15(5):2024-31.
  • Size / Price
    Cat No: HG10987-CF
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".