After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 COX-2/PTGS2 Gene ORF cDNA clone expression plasmid

데이터시트리뷰관련제품프로토콜
Human PTGS2 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_000963
cDNA 크기:1815bp
cDNA 설명:Full length Clone DNA of Homo sapiens prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase).
유전자 동의어:COX2
:Human
벡터:pCMV3-untagged
Plasmid:pCMV3-PTGS2
제한 사이트:HindIII + XbaI (6.1kb + 1.82kb)
태그 씨퀀스:
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Human PTGS2 Gene Plasmid Map
Human PTGS2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
연구배경

PTGS2, also known as COX-2, is s component of Prostaglandin-endoperoxide synthase (PTGS). PTGS, also known as cyclooxygenase, is the key enzyme in prostaglandin biosynthesis, and acts both as a dioxygenase and as a peroxidase. There are two isozymes of PTGS: a constitutive PTGS1 and an inducible PTGS2, which differ in their regulation of expression and tissue distribution. PTGS2 is over expressed in many cancers. The overexpression of PTGS2 along with increased angiogenesis and GLUT-1 expression is significantly associated with gallbladder carcinomas. Furthermore the product of COX-2, PGH2 is converted by prostaglandin E2 synthase into PGE2, which in turn can stimulate cancer progression. Consequently inhibiting COX-2 may have benefit in the prevention and treatment of these types of cancer. PTGS2 is regulated by specific stimulatory events, suggesting that it is responsible for the prostanoid biosynthesis involved in inflammation and mitogenesis. It mediates the formation of prostaglandins from arachidonate and may have a role as a major mediator of inflammation and/or a role for prostanoid signaling in activity-dependent plasticity.

참고자료
  • Picot, et al. (1994) The X-ray crystal structure of the membrane protein prostaglandin H2 synthase-1. Nature. 367(6460):243-9.
  • Xie W, et al. (1991) Expression of a Mitogen-Responsive Gene Encoding Prostaglandin Synthase is Regulated by mRNA Splicing. Proceedings of the National Academy of Sciences. 88(7):2692-6.
  • Hla T, et al. (1992) Human Cyclooxygenase-2 cDNA. Proceedings of the National Academy of Sciences. 89(16):7384-8.
  • Size / Price
    Cat No: HG12036-UT
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보In Stock
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
    • Human PTGS2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".