After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

휴먼 PTPN2/TC-PTP transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag 태그

데이터시트리뷰관련제품프로토콜
Human PTPN2 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_002828.2
cDNA 크기:1248bp
cDNA 설명:Full length Clone DNA of Homo sapiens protein tyrosine phosphatase, non-receptor type 2, transcript variant 1 with N terminal Flag tag.
유전자 동의어:PTPT, TCPTP, TC-PTP, TCELLPTP
:Human
벡터:pCMV3-N-FLAG
Plasmid:pCMV3-Flag-PTPN2
제한 사이트:KpnI + NotI (6kb + 1.29kb)
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Human PTPN2 Gene Plasmid Map
Human PTPN2 transcript variant 1 ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

휴먼 PTPN2/TC-PTP transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag 태그 on other vectors
휴먼 PTPN2/TC-PTP transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG10570-ACG265262
휴먼 PTPN2/TC-PTP transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG10570-ACR265262
휴먼 PTPN2/TC-PTP transcript variant 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG10570-ANG265262
휴먼 PTPN2/TC-PTP transcript variant 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG10570-ANR265262
휴먼 PTPN2/TC-PTP transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG10570-CF229893
휴먼 PTPN2/TC-PTP transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His 태그HG10570-CH229893
휴먼 PTPN2/TC-PTP transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc 태그HG10570-CM229893
휴먼 PTPN2/TC-PTP transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA 태그HG10570-CY229893
휴먼 PTPN2/TC-PTP transcript variant 1 Gene ORF cDNA clone in cloning vectorHG10570-M88421
휴먼 PTPN2/TC-PTP transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag 태그HG10570-NF229893
휴먼 PTPN2/TC-PTP transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His 태그HG10570-NH229893
휴먼 PTPN2/TC-PTP transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc 태그HG10570-NM229893
휴먼 PTPN2/TC-PTP transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA 태그HG10570-NY229893
휴먼 PTPN2/TC-PTP transcript variant 1 Gene ORF cDNA clone expression plasmidHG10570-UT229893
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

Tyrosine-protein phosphatase non-receptor type 2, also known as T-cell protein-tyrosine phosphatase, PTPN2 and PTPT, is a cytoplasm protein which belongs to the protein-tyrosine phosphatase family and Non-receptor class 1 subfamily. Members of the protein tyrosine phosphatase ( PTP ) family share a highly conserved catalytic motif, which is essential for the catalytic activity. TC-PTP / PTPN2 is a cytosolic tyrosine phosphatase that functions as a negative regulator of a variety of tyrosine kinases and other signaling proteins. The expression of TC-PTP / PTPN2 plays a role of tumor suppressor and may modulate response to treatment. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. Epidermal growth factor receptor and the adaptor protein Shc were reported to be substrates of this PTP, which suggested the roles in growth factor mediated cell signaling. TC-PTP / PTPN2 is an enzyme that is essential for the proper functioning of the immune system and that participates in the control of cell proliferation, and inflammation. TC-PTP / PTPN2 was identified as a negative regulator of NUP214-ABL1 kinase activity.

Size / Price
Cat No: HG10570-NF
정가: 
가격:      (You Save: )
크기:
수량:+-
재고정보In Stock
대량 주문 문의장바구니에 추가
Contact Us
이미지
  • Human PTPN2 transcript variant 1 ORF mammalian expression plasmid, N-Flag tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".