RAB11A cDNA ORF Clone, Human, C-His tag

Cat: HG14014-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RAB11A Reagents
CRO Services
Product recommended

All RAB11A Reagents
RAB11A cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
651 bp
Description
Full length Clone DNA of Human RAB11A, member RAS oncogene family with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RAB11A cDNA ORF Clone, Human, C-His tag Alternative Names
YL8 cDNA ORF Clone, Human
RAB11A Background Information
Full Name
RAB11A, member RAS oncogene family

RAB11A cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RAB11A cDNA ORF Clone in Cloning Vector, Rat RG82945-U
RAB11A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82945-ACGLN

RAB11A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RAB11A cDNA ORF Clone in Cloning Vector, Mouse MG52314-U
RAB11A cDNA ORF Clone, Mouse, untagged MG52314-UT
RAB11A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52314-ACG
RAB11A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52314-ACGLN
RAB11A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52314-ANG
RAB11A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52314-ACR
RAB11A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52314-ANR
RAB11A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52314-CF
RAB11A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52314-NF
RAB11A cDNA ORF Clone, Mouse, C-His tag MG52314-CH
RAB11A cDNA ORF Clone, Mouse, N-His tag MG52314-NH
RAB11A cDNA ORF Clone, Mouse, C-HA tag MG52314-CY
RAB11A cDNA ORF Clone, Mouse, N-HA tag MG52314-NY
RAB11A cDNA ORF Clone, Mouse, C-Myc tag MG52314-CM
RAB11A cDNA ORF Clone, Mouse, N-Myc tag MG52314-NM
RAB11A qPCR Primer Pairs, Mouse MP202187

RAB11A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RAB11A cDNA ORF Clone in Cloning Vector, Human HG14014-G
RAB11A cDNA ORF Clone, Human, untagged HG14014-UT
RAB11A cDNA ORF Clone, Human, C-GFPSpark® tag HG14014-ACG
RAB11A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14014-ACGLN
RAB11A cDNA ORF Clone, Human, N-GFPSpark® tag HG14014-ANG
RAB11A cDNA ORF Clone, Human, C-OFPSpark® tag HG14014-ACR
RAB11A cDNA ORF Clone, Human, N-OFPSpark® tag HG14014-ANR
RAB11A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14014-CF
RAB11A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14014-NF
RAB11A cDNA ORF Clone, Human, N-His tag HG14014-NH
RAB11A cDNA ORF Clone, Human, C-HA tag HG14014-CY
RAB11A cDNA ORF Clone, Human, N-HA tag HG14014-NY
RAB11A cDNA ORF Clone, Human, C-Myc tag HG14014-CM
RAB11A cDNA ORF Clone, Human, N-Myc tag HG14014-NM
RAB11A qPCR Primer Pairs, Human HP102670
info info
添加购物车成功! 添加购物车失败!