RAB22A cDNA ORF Clone, Human, C-His tag

Cat: HG14588-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All RAB22A Reagents

CRO Services

Product recommended


All RAB22A Reagents

RAB22A cDNA ORF Clone, Human, C-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
585 bp
Description
Full length Clone DNA of Human RAB22A, member RAS oncogene family with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RAB22A Background Information

Full Name
RAB22A, member RAS oncogene family

RAB22A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RAB22A cDNA ORF Clone in Cloning Vector, Mouse MG53252-U
RAB22A cDNA ORF Clone, Mouse, untagged MG53252-UT
RAB22A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53252-ACGLN
RAB22A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53252-ACG
RAB22A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53252-ANG
RAB22A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53252-ACR
RAB22A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53252-ANR
RAB22A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53252-CF
RAB22A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53252-NF
RAB22A cDNA ORF Clone, Mouse, C-His tag MG53252-CH
RAB22A cDNA ORF Clone, Mouse, N-His tag MG53252-NH
RAB22A cDNA ORF Clone, Mouse, C-HA tag MG53252-CY
RAB22A cDNA ORF Clone, Mouse, N-HA tag MG53252-NY
RAB22A cDNA ORF Clone, Mouse, C-Myc tag MG53252-CM
RAB22A cDNA ORF Clone, Mouse, N-Myc tag MG53252-NM

RAB22A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RAB22A cDNA ORF Clone in Cloning Vector, Human HG14588-G
RAB22A cDNA ORF Clone, Human, untagged HG14588-UT
RAB22A cDNA ORF Clone, Human, C-GFPSpark® tag HG14588-ACG
RAB22A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14588-ACGLN
RAB22A cDNA ORF Clone, Human, C-OFPSpark® tag HG14588-ACR
RAB22A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14588-CF
RAB22A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14588-NF
RAB22A cDNA ORF Clone, Human, N-His tag HG14588-NH
RAB22A cDNA ORF Clone, Human, C-HA tag HG14588-CY
RAB22A cDNA ORF Clone, Human, N-HA tag HG14588-NY
RAB22A cDNA ORF Clone, Human, C-Myc tag HG14588-CM
RAB22A cDNA ORF Clone, Human, N-Myc tag HG14588-NM
RAB22A qPCR Primer Pairs, Human HP103223
info info
添加购物车成功! 添加购物车失败!