RAB35 cDNA ORF Clone, Human, C-His tag

Cat: HG14591-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All RAB35 Reagents

CRO Services

Product recommended


All RAB35 Reagents

RAB35 cDNA ORF Clone, Human, C-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
606 bp
Description
Full length Clone DNA of Human RAB35, member RAS oncogene family with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RAB35 cDNA ORF Clone, Human, C-His tag Alternative Names

H-ray cDNA ORF Clone, Human;RAB1C cDNA ORF Clone, Human;RAY cDNA ORF Clone, Human

RAB35 Background Information

Full Name
RAB35, member RAS oncogene family

RAB35 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RAB35 cDNA ORF Clone in Cloning Vector, Mouse MG5A0385-U
RAB35 cDNA ORF Clone, Mouse, untagged MG5A0385-UT
RAB35 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0385-ACGLN
RAB35 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0385-ACG
RAB35 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A0385-ANG
RAB35 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A0385-ACR
RAB35 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A0385-ANR
RAB35 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A0385-CF
RAB35 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A0385-NF
RAB35 cDNA ORF Clone, Mouse, C-His tag MG5A0385-CH
RAB35 cDNA ORF Clone, Mouse, N-His tag MG5A0385-NH
RAB35 cDNA ORF Clone, Mouse, C-HA tag MG5A0385-CY
RAB35 cDNA ORF Clone, Mouse, N-HA tag MG5A0385-NY
RAB35 cDNA ORF Clone, Mouse, C-Myc tag MG5A0385-CM
RAB35 cDNA ORF Clone, Mouse, N-Myc tag MG5A0385-NM

RAB35 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RAB35 cDNA ORF Clone in Cloning Vector, Human HG14591-G
RAB35 cDNA ORF Clone, Human, untagged HG14591-UT
RAB35 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14591-ACGLN
RAB35 cDNA ORF Clone, Human, C-GFPSpark® tag HG14591-ACG
RAB35 cDNA ORF Clone, Human, C-OFPSpark® tag HG14591-ACR
RAB35 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14591-CF
RAB35 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14591-NF
RAB35 cDNA ORF Clone, Human, N-His tag HG14591-NH
RAB35 cDNA ORF Clone, Human, C-HA tag HG14591-CY
RAB35 cDNA ORF Clone, Human, N-HA tag HG14591-NY
RAB35 cDNA ORF Clone, Human, C-Myc tag HG14591-CM
RAB35 cDNA ORF Clone, Human, N-Myc tag HG14591-NM
RAB35 qPCR Primer Pairs, Human HP103225
info info
添加购物车成功! 添加购物车失败!