RASSF5 cDNA ORF Clone, Human, C-HA tag

Cat: HG15161-CY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All RASSF5 Reagents

CRO Services

Product recommended


All RASSF5 Reagents

RASSF5 cDNA ORF Clone, Human, C-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
798 bp
Description
Full length Clone DNA of Human Ras association (RalGDS/AF-6) domain family member 5 with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RASSF5 cDNA ORF Clone, Human, C-HA tag Alternative Names

Maxp1 cDNA ORF Clone, Human;NORE1 cDNA ORF Clone, Human;NORE1A cDNA ORF Clone, Human;NORE1B cDNA ORF Clone, Human;RAPL cDNA ORF Clone, Human;RASSF3 cDNA ORF Clone, Human

RASSF5 Background Information

Full Name
Ras association (RalGDS/AF-6) domain family member 5

RASSF5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RASSF5 cDNA ORF Clone in Cloning Vector, Mouse MG59413-U
RASSF5 cDNA ORF Clone, Mouse, untagged MG59413-UT
RASSF5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59413-ACGLN
RASSF5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59413-ACG
RASSF5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG59413-ANG
RASSF5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG59413-ACR
RASSF5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG59413-ANR
RASSF5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59413-CF
RASSF5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG59413-NF
RASSF5 cDNA ORF Clone, Mouse, C-His tag MG59413-CH
RASSF5 cDNA ORF Clone, Mouse, N-His tag MG59413-NH
RASSF5 cDNA ORF Clone, Mouse, C-HA tag MG59413-CY
RASSF5 cDNA ORF Clone, Mouse, N-HA tag MG59413-NY
RASSF5 cDNA ORF Clone, Mouse, C-Myc tag MG59413-CM
RASSF5 cDNA ORF Clone, Mouse, N-Myc tag MG59413-NM

RASSF5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RASSF5 cDNA ORF Clone in Cloning Vector, Human HG15161-G
RASSF5 cDNA ORF Clone, Human, untagged HG15161-UT
RASSF5 cDNA ORF Clone, Human, C-GFPSpark® tag HG15161-ACG
RASSF5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15161-ACGLN
RASSF5 cDNA ORF Clone, Human, N-GFPSpark® tag HG15161-ANG
RASSF5 cDNA ORF Clone, Human, C-OFPSpark® tag HG15161-ACR
RASSF5 cDNA ORF Clone, Human, N-OFPSpark® tag HG15161-ANR
RASSF5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15161-CF
RASSF5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15161-NF
RASSF5 cDNA ORF Clone, Human, C-His tag HG15161-CH
RASSF5 cDNA ORF Clone, Human, N-His tag HG15161-NH
RASSF5 cDNA ORF Clone, Human, N-HA tag HG15161-NY
RASSF5 cDNA ORF Clone, Human, C-Myc tag HG15161-CM
RASSF5 cDNA ORF Clone, Human, N-Myc tag HG15161-NM
RASSF5 qPCR Primer Pairs, Human HP103788
info info
添加购物车成功! 添加购物车失败!