휴먼 REG3A Gene ORF cDNA clone expression plasmid, C-Myc 태그

    데이터시트리뷰관련제품프로토콜
    휴먼 REG3A cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_002580.1
    cDNA 크기:528bp
    cDNA 설명:Full length Clone DNA of Homo sapiens regenerating islet-derived 3 alpha with C terminal Myc tag.
    유전자 동의어:HIP, PAP, PAP1, REG3, PAP-H, PBCGF, REG-III, REG3A
    :Human
    벡터:pCMV3-C-Myc
    Plasmid:
    제한 사이트:
    태그 씨퀀스:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with REG3A qPCR primers for gene expression analysis, HP101179 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    연구배경

    Regenerating islet-derived protein 3-alpha, also known as Regenerating islet-derived protein III-alpha, REG-3-alpha, REG3A, and HIP, is secreted protein which contains one C-type lectin domain. REG3A is constitutively expressed in intestine, and is a pancreatic secretory protein that may be involved in cell proliferation or differentiation. It is overexpressed during the acute phase of pancreatitis and in some patients with chronic pancreatitis. REG3A and REG1A proteins are both involved in liver and pancreatic regeneration and proliferation. REG3A is also a stress protein involved in the control of bacterial proliferation. REG3A is down-regulated in most primary human gastric cancer cells, and might be useful in the diagnosis of gastric cancer. Additionally, REG3A is a target of beta-catenin signaling in Huh7 hepatoma cells. The REG1A and REG3A are downstream targets of the Wnt pathway during liver tumorigenesis.

    참고자료
  • Cavard C, et al. (2006) Overexpression of regenerating islet-derived 1 alpha and 3 alpha genes in human primary liver tumors with beta-catenin mutations. Oncogene. 25(4): 599-608.
  • Choi B, et al. (2007) Downregulation of regenerating islet-derived 3 alpha (REG3A) in primary human gastric adenocarcinomas. Exp Mol Med. 39(6): 796-804.
  • Size / Price
    Cat No: HG11235-CM
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".