휴먼 REG4 Gene ORF cDNA clone expression plasmid

    데이터시트리뷰관련제품프로토콜
    휴먼 REG4 cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_032044.2
    cDNA 크기:477bp
    cDNA 설명:Full length Clone DNA of Homo sapiens regenerating islet-derived family, member 4.
    유전자 동의어:GISP, RELP, REG-IV, REG4
    :Human
    벡터:pCMV3-untagged
    Plasmid:
    제한 사이트:
    태그 씨퀀스:
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with REG4 qPCR primers for gene expression analysis, HP101092 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    연구배경

    Regenerating islet-derived protein 4, also known as REG-like protein, REG4, GISP and RELP, a member of the regenerating gene family belonging to the calcium (C-type) dependent lectin superfamily, has been found to be involved in malignancy in several different organs including the stomach, colorectum, pancreas and prostate. It is highly expressed in the gastrointestinal tract and markedly up-regulated in colon adenocarcinoma, pancreatic cancer, gastric adenocarcinoma, and inflammatory bowel disease. Expression of the Reg4 in different cell types has been associated with regeneration, cell growth and cell survival, cell adhesion and resistance to apoptosis. REG4 protein overexpression is associated with an unfavorable response to preoperative chemoradiotherapy and may be used as a predictive biomarker clinically. REG4 may play an important role in the development and progression of colorectal cancer, as well as in intestinal morphogenesis and epithelium restitution.

    참고자료
  • Li FY, et al. (2010) RegIV expression showing specificity to gastrointestinal tract and its potential role in diagnosing digestive tract neuroendocrine tumor. J Zhejiang Univ Sci B. 11(4):258-66.
  • Rafa L, et al. (2010) REG4 acts as a mitogenic, motility and pro-invasive factor for colon cancer cells. Int J Oncol. 36(3): 689-98.
  • Hu G, et al. (2010) Purification of a bioactive recombinant human Reg IV expressed in Escherichia coli. Protein Expr Purif. 69(2): 186-90.
  • Size / Price
    Cat No: HG11186-UT
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".