After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 RELA / Transcription factor p65 Gene ORF cDNA clone expression plasmid, C-His 태그

데이터시트리뷰관련제품프로토콜
Human RELA cDNA 클론 제품 정보
Gene_bank_ref_id:NM_021975
cDNA 크기:1656bp
cDNA 설명:Full length Clone DNA of Homo sapiens v-rel reticuloendotheliosis viral oncogene homolog A (avian) with C terminal His tag.
유전자 동의어:p65
:Human
벡터:pCMV3-C-His
Plasmid:pCMV3-RELA-His
제한 사이트:KpnI + XbaI (6kb + 1.7kb)
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Human RELA Gene Plasmid Map
Human RELA / Transcription factor p65 / NFkB p65 ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

휴먼 RELA / Transcription factor p65 Gene ORF cDNA clone expression plasmid, C-His 태그 on other vectors
휴먼 RELA / Transcription factor p65 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG12054-ACG288840
휴먼 RELA / Transcription factor p65 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG12054-ACR288840
휴먼 RELA / Transcription factor p65 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG12054-ANG288840
휴먼 RELA / Transcription factor p65 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG12054-ANR288840
휴먼 RELA / Transcription factor p65 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG12054-CF253470
휴먼 RELA / Transcription factor p65 Gene ORF cDNA clone expression plasmid, C-His 태그HG12054-CH253470
휴먼 RELA / Transcription factor p65 Gene ORF cDNA clone expression plasmid, C-Myc 태그HG12054-CM253470
휴먼 RELA / Transcription factor p65 Gene ORF cDNA clone expression plasmid, C-HA 태그HG12054-CY253470
휴먼 RELA / Transcription factor p65 Gene ORF cDNA clone in cloning vectorHG12054-G88420
휴먼 RELA / Transcription factor p65 Gene ORF cDNA clone expression plasmid, N-Flag 태그HG12054-NF253470
휴먼 RELA / Transcription factor p65 Gene ORF cDNA clone expression plasmid, N-His 태그HG12054-NH253470
휴먼 RELA / Transcription factor p65 Gene ORF cDNA clone expression plasmid, N-Myc 태그HG12054-NM253470
휴먼 RELA / Transcription factor p65 Gene ORF cDNA clone expression plasmid, N-HA 태그HG12054-NY253470
휴먼 RELA / Transcription factor p65 Gene ORF cDNA clone expression plasmidHG12054-UT253470
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

RELA (v-rel reticuloendotheliosis viral oncogene homolog A), also known as Nuclear factor NF-kappa-B p65 subunit, or Transcription factor p65, is a transcription factor expressed in growth plate chondrocytes where it facilitates chondrogenesis. The v-rel avian reticuloendotheliosis viral oncogene homolog A (RELA) gene encodes the major component of the NF-?B complex. NF-kappaB is a generic name for an evolutionarily conserved transcription-factor system that contributes to the mounting of an effective immune response but is also involved in the regulation of cell proliferation, development, and apoptosis. The implication of NF-kappaB in central biological processes and its extraordinary connectivity to other signaling pathways raise a need for highly controlled regulation of NF-kappaB activity at several levels. The mammalian Rel/NF-kappaB family of transcription factors, including RelA, c-Rel, RelB, NF-kappaB1 (p50 and its precursor p105), and NF-kappaB2 (p52 and its precursor p100), plays a central role in the immune system by regulating several processes ranging from the development and survival of lymphocytes and lymphoid organs to the control of immune responses and malignant transformation.

참고자료
  • Hashimoto R, et al. (2011) Variants of the RELA gene are associated with schizophrenia and their startle responses. Neuropsychopharmacology. 36(9): 1921-31.
  • Vallabhapurapu S, et al. (2009) Regulation and function of NF-kappaB transcription factors in the immune system. Annu Rev Immunol. 27: 693-733.
  • Schmitz ML, et al. (2004) NF-kappaB: a multifaceted transcription factor regulated at several levels. Chembiochem. 5(10): 1348-58.
  • Size / Price
    Cat No: HG12054-CH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보In Stock
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
    • Human RELA / Transcription factor p65 / NFkB p65 ORF mammalian expression plasmid, C-His tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".