휴먼 RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid

    데이터시트리뷰관련제품프로토콜
    휴먼 RGS5 cDNA 클론 제품 정보
    Gene_bank_ref_id:BC030059
    cDNA 크기:546bp
    cDNA 설명:Full length Clone DNA of Homo sapiens regulator of G-protein signaling 5 DNA.
    유전자 동의어:MST092, MST106, MST129, MSTP032, MSTP092, MSTP106, MSTP129
    :Human
    벡터:pCMV3-untagged
    Plasmid:
    제한 사이트:
    태그 씨퀀스:
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with RGS5 qPCR primers for gene expression analysis, HP103860 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    휴먼 RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid on other vectors
    휴먼 RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG15234-ACG265260
    휴먼 RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG15234-ACR265260
    휴먼 RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG15234-ANG265260
    휴먼 RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG15234-ANR265260
    휴먼 RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG15234-CF229890
    휴먼 RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, C-His 태그HG15234-CH229890
    휴먼 RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, C-Myc 태그HG15234-CM229890
    휴먼 RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, C-HA 태그HG15234-CY229890
    휴먼 RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone in cloning vectorHG15234-G88420
    휴먼 RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, N-Flag 태그HG15234-NF229890
    휴먼 RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, N-His 태그HG15234-NH229890
    휴먼 RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, N-Myc 태그HG15234-NM229890
    휴먼 RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, N-HA 태그HG15234-NY229890
    휴먼 RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmidHG15234-UT229890
     발현 벡터에 대해 자세히 알아보기
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".