휴먼 RhoA Gene ORF cDNA clone expression plasmid, N-HA 태그

    데이터시트리뷰관련제품프로토콜
    휴먼 RHOA cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_001664.2
    cDNA 크기:582bp
    cDNA 설명:Full length Clone DNA of Homo sapiens ras homolog gene family, member A with N terminal HA tag.
    유전자 동의어:ARHA, ARH12, RHO12, RHOH12, RHOA
    :Human
    벡터:pCMV3-SP-N-HA
    Plasmid:
    제한 사이트:
    태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with RHOA qPCR primers for gene expression analysis, HP100025 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    연구배경

    Transforming protein RhoA, also known as Rho cDNA clone 12, Ras homolog gene family member A, RHOA and ARH12, is a cell membrane and cytoplasm protein which belongs to the small GTPase superfamily and Rho family. The Rho family of small GTPases plays a key role in the dynamic regulation of the actin cytoskeleton that underlies various important cellular functions such as shape changes, migration, and polarity. RHOA / ARH12 is part of a larger family of related proteins known as the Ras superfamily; proteins involved in the regulation and timing of cell division. RHOA / ARH12 is a small GTPase protein known to regulate the actin cytoskeleton in the formation of stress fibers. It acts upon two known effector proteins: ROCK1 (Rho-associated, coiled-coil containing protein kinase 1) and DIAPH1 ( diaphanous homolog 1 (Drosophila) ). RHOA / ARH12 regulates a signal transduction pathway linking plasma membrane receptors to the assembly of focal adhesions and actin stress fibers. RHOA / ARH12 serves as a target for the yopT cysteine peptidase from Yersinia pestis, vector of the plague, and Yersinia pseudotuberculosis, which causes gastrointestinal disorders. RHOA / ARH12 may be an activator of PLCE1. It is activated by ARHGEF2, which promotes the exchange of GDP for GTP.

    참고자료
  • Kiss C, et al.,1997, Cytogenet. Cell Genet. 79 (3-4): 228-30.
  • Anastasiadis,P.Z. et al., 2000, Nat Cell Biol. 2 (9):637-44.
  • Yiu G, et al.,2006, Nat. Rev. Neurosci. 7 (8): 617-27.
  • Wang,HR. et al., 2006, Methods Enzymol. 406 :437-47.
  • Heo,J. et al., 2006, Biochemistry. 45 (48):14481-9.
  • Size / Price
    Cat No: HG12110-NY
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".