RNF4 cDNA ORF Clone, Human, C-HA tag

Cat: HG15758-CY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All RNF4 Reagents

CRO Services

Product recommended


All RNF4 Reagents

RNF4 cDNA ORF Clone, Human, C-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
573 bp
Description
Full length Clone DNA of Human ring finger protein 4 with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RNF4 cDNA ORF Clone, Human, C-HA tag Alternative Names

RES4-26 cDNA ORF Clone, Human;SLX5 cDNA ORF Clone, Human;SNURF cDNA ORF Clone, Human

RNF4 Background Information

Full Name
ring finger protein 4

RNF4 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RNF4 cDNA ORF Clone in Cloning Vector, Rat RG84174-U
RNF4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG84174-ACGLN

RNF4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RNF4 cDNA ORF Clone in Cloning Vector, Mouse MG59884-U
RNF4 cDNA ORF Clone, Mouse, untagged MG59884-UT
RNF4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59884-ACG
RNF4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59884-ACGLN
RNF4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG59884-ANG
RNF4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG59884-ACR
RNF4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG59884-ANR
RNF4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59884-CF
RNF4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG59884-NF
RNF4 cDNA ORF Clone, Mouse, C-His tag MG59884-CH
RNF4 cDNA ORF Clone, Mouse, N-His tag MG59884-NH
RNF4 cDNA ORF Clone, Mouse, C-HA tag MG59884-CY
RNF4 cDNA ORF Clone, Mouse, N-HA tag MG59884-NY
RNF4 cDNA ORF Clone, Mouse, C-Myc tag MG59884-CM
RNF4 cDNA ORF Clone, Mouse, N-Myc tag MG59884-NM

RNF4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RNF4 cDNA ORF Clone in Cloning Vector, Human HG15758-G
RNF4 cDNA ORF Clone, Human, untagged HG15758-UT
RNF4 cDNA ORF Clone, Human, C-GFPSpark® tag HG15758-ACG
RNF4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15758-ACGLN
RNF4 cDNA ORF Clone, Human, N-GFPSpark® tag HG15758-ANG
RNF4 cDNA ORF Clone, Human, C-OFPSpark® tag HG15758-ACR
RNF4 cDNA ORF Clone, Human, N-OFPSpark® tag HG15758-ANR
RNF4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15758-CF
RNF4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15758-NF
RNF4 cDNA ORF Clone, Human, C-His tag HG15758-CH
RNF4 cDNA ORF Clone, Human, N-His tag HG15758-NH
RNF4 cDNA ORF Clone, Human, N-HA tag HG15758-NY
RNF4 cDNA ORF Clone, Human, C-Myc tag HG15758-CM
RNF4 cDNA ORF Clone, Human, N-Myc tag HG15758-NM
RNF4 qPCR Primer Pairs, Human HP104350
info info
添加购物车成功! 添加购物车失败!