휴먼 RPE / RPE2-1 Gene ORF cDNA clone expression plasmid

    데이터시트리뷰관련제품프로토콜
    휴먼 RPE cDNA 클론 제품 정보
    Gene_bank_ref_id:BC005148
    cDNA 크기:687bp
    cDNA 설명:Full length Clone DNA of Homo sapiens ribulose-5-phosphate-3-epimerase.
    유전자 동의어:HUSSY-17, MGC2636, RPE2-1, RPE
    :Human
    벡터:pCMV3-untagged
    Plasmid:
    제한 사이트:
    태그 씨퀀스:
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with RPE qPCR primers for gene expression analysis, HP102888 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    연구배경

    The "ribulose phosphate binding" superfamily defined by the Structural Classification of Proteins (SCOP) database is considered the result of divergent evolution from a common (beta/alpha)(8)-barrel ancestor. The superfamily includes d-ribulose 5-phosphate 3-epimerase (RPE), orotidine 5'-monophosphate decarboxylase (OMPDC), and 3-keto-l-gulonate 6-phosphate decarboxylase (KGPDC). Replication of the human genome requires the activation of thousands of replicons distributed along each one of the chromosomes. Each replicon contains an initiation, or origin, site, at which DNA synthesis begins. In enzymology, a L-ribulose-5-phosphate 3-epimerase is an enzyme that catalyzes the chemical reaction L-ribulose 5-phosphate to L-xylulose 5-phosphate. Hence, RPE has one substrate, L-ribulose 5-phosphate, and one product, L-xylulose 5-phosphate. RPE belongs to the family of isomerases, specifically those racemases and epimerases acting on carbohydrates and derivatives. The systematic name of this enzyme class is L-ribulose-5-phosphate 3-epimerase. Other names in common use include L-xylulose 5-phosphate 3-epimerase, UlaE, and SgaU.

    참고자료
  • Yew WS, et al., 2002,  J. Bacteriol. 184 (1): 302-6.
  • Shimaoka, M. et al., 2005, Biosci Biotechnol Biochem  69 (7):1248-55.
  • Salinero,KK. et al., 2009,  BMC Genomics 10 :351.
  • Size / Price
    Cat No: HG14238-UT
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".