After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

휴먼 RPGR transcript variant A Gene ORF cDNA clone expression plasmid, N-HA 태그

데이터시트리뷰관련제품프로토콜
Human RPGR cDNA 클론 제품 정보
Gene_bank_ref_id:NM_000328.2
cDNA 크기:2448bp
cDNA 설명:Full length Clone DNA of Homo sapiens retinitis pigmentosa GTPase regulator, transcript variant A with N terminal HA tag.
유전자 동의어:CRD, RP3, COD1, PCDX, RP15, XLRP3, orf15, CORDX1
:Human
벡터:pCMV3-N-HA
Plasmid:
제한 사이트:
태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

휴먼 RPGR transcript variant A Gene ORF cDNA clone expression plasmid, N-HA 태그 on other vectors
휴먼 RPGR transcript variant A Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG10525-ACG288840
휴먼 RPGR transcript variant A Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG10525-ACR288840
휴먼 RPGR transcript variant A Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG10525-ANG288840
휴먼 RPGR transcript variant A Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG10525-ANR288840
휴먼 RPGR transcript variant A Gene ORF cDNA clone expression plasmid, C-Flag 태그HG10525-CF253470
휴먼 RPGR transcript variant A Gene ORF cDNA clone expression plasmid, C-His 태그HG10525-CH253470
휴먼 RPGR transcript variant A Gene ORF cDNA clone expression plasmid, C-Myc 태그HG10525-CM253470
휴먼 RPGR transcript variant A Gene ORF cDNA clone expression plasmid, C-HA 태그HG10525-CY253470
휴먼 RPGR transcript variant A Gene ORF cDNA clone in cloning vectorHG10525-M88420
휴먼 RPGR transcript variant A Gene ORF cDNA clone expression plasmid, C-Flag 태그HG10525-M-F253470
휴먼 RPGR transcript variant A Gene ORF cDNA clone expression plasmid, N-Flag 태그HG10525-NF253470
휴먼 RPGR transcript variant A Gene ORF cDNA clone expression plasmid, N-His 태그HG10525-NH253470
휴먼 RPGR transcript variant A Gene ORF cDNA clone expression plasmid, N-Myc 태그HG10525-NM253470
휴먼 RPGR transcript variant A Gene ORF cDNA clone expression plasmid, N-HA 태그HG10525-NY253470
휴먼 RPGR transcript variant A Gene ORF cDNA clone expression plasmidHG10525-UT253470
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
Size / Price
Cat No: HG10525-NY
정가: 
가격:      (You Save: )
크기:
수량:+-
재고정보2-3 weeks
대량 주문 문의장바구니에 추가
Contact Us
이미지
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".