RPS9 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG16341-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RPS9 Reagents
CRO Services
Product recommended

All RPS9 Reagents
RPS9 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
585 bp
Description
Full length Clone DNA of Human ribosomal protein S9 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RPS9 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
S9 cDNA ORF Clone, Human
RPS9 Background Information
Full Name
ribosomal protein S9

RPS9 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
RPS9 cDNA ORF Clone in Cloning Vector, Ferret FG60081-G
RPS9 cDNA ORF Clone, Ferret, untagged FG60081-UT
RPS9 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60081-ACG
RPS9 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60081-ANG
RPS9 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60081-ACR
RPS9 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60081-ANR
RPS9 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60081-CF
RPS9 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60081-NF
RPS9 cDNA ORF Clone, Ferret, C-His tag FG60081-CH
RPS9 cDNA ORF Clone, Ferret, N-His tag FG60081-NH
RPS9 cDNA ORF Clone, Ferret, C-HA tag FG60081-CY
RPS9 cDNA ORF Clone, Ferret, N-HA tag FG60081-NY
RPS9 cDNA ORF Clone, Ferret, C-Myc tag FG60081-CM
RPS9 cDNA ORF Clone, Ferret, N-Myc tag FG60081-NM

RPS9 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RPS9 cDNA ORF Clone in Cloning Vector, Mouse MG53648-U
RPS9 cDNA ORF Clone, Mouse, untagged MG53648-UT
RPS9 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53648-ACGLN
RPS9 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53648-ACG
RPS9 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53648-ANG
RPS9 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53648-ACR
RPS9 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53648-ANR
RPS9 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53648-CF
RPS9 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53648-NF
RPS9 cDNA ORF Clone, Mouse, C-His tag MG53648-CH
RPS9 cDNA ORF Clone, Mouse, N-His tag MG53648-NH
RPS9 cDNA ORF Clone, Mouse, C-HA tag MG53648-CY
RPS9 cDNA ORF Clone, Mouse, N-HA tag MG53648-NY
RPS9 cDNA ORF Clone, Mouse, C-Myc tag MG53648-CM
RPS9 cDNA ORF Clone, Mouse, N-Myc tag MG53648-NM

RPS9 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RPS9 cDNA ORF Clone in Cloning Vector, Human HG16341-G
RPS9 cDNA ORF Clone, Human, untagged HG16341-UT
RPS9 cDNA ORF Clone, Human, C-GFPSpark® tag HG16341-ACG
RPS9 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16341-ACGLN
RPS9 cDNA ORF Clone, Human, N-GFPSpark® tag HG16341-ANG
RPS9 cDNA ORF Clone, Human, C-OFPSpark® tag HG16341-ACR
RPS9 cDNA ORF Clone, Human, N-OFPSpark® tag HG16341-ANR
RPS9 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16341-CF
RPS9 cDNA ORF Clone, Human, C-His tag HG16341-CH
RPS9 cDNA ORF Clone, Human, N-His tag HG16341-NH
RPS9 cDNA ORF Clone, Human, C-HA tag HG16341-CY
RPS9 cDNA ORF Clone, Human, N-HA tag HG16341-NY
RPS9 cDNA ORF Clone, Human, C-Myc tag HG16341-CM
RPS9 cDNA ORF Clone, Human, N-Myc tag HG16341-NM
RPS9 qPCR Primer Pairs, Human HP105094
info info
添加购物车成功! 添加购物车失败!