S100A11 cDNA ORF Clone, Human, C-HA tag

Cat: HG11140-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All S100A11 Reagents
CRO Services
Product recommended

All S100A11 Reagents
S100A11 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
318 bp
Description
Full length Clone DNA of Human S100 calcium binding protein A11 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

S100A11 cDNA ORF Clone, Human, C-HA tag Alternative Names
HEL-S-43 cDNA ORF Clone, Human;MLN70 cDNA ORF Clone, Human;S100C cDNA ORF Clone, Human
S100A11 Background Information

Protein S100-A11, also known as S100 calcium-binding protein A11, S100A11 and MLN70, is a member of the S-100 family. S100A11 is widely expressed in multiple tissues, and is located in cytoplasm, nucleus, and even cell periphery. S100A11 exists as a non-covalent homodimer with an antiparallel conformation. Ca(2+) binding to S100A11 would trigger conformational changes which would expose the hydrophobic cleft of S100A11 and facilitate its interaction with target proteins. As a dual cell growth mediator, S100A11 acts as either a tumor suppressor or promoter in many different types of tumors and would play respective roles in influencing the proliferation of the cancer cells. In the nucleus, S100A11 suppresses the growth of keratinocytes through p21 (CIP1/WAF1) activation and induces cell differentiation. S100A11 is also a novel diagnostic marker in breast carcinoma.

Full Name
S100 calcium binding protein A11
References
  • Miyasaki KT. et al., 1993, J Dent Res. 72: 517-23.
  • Ohuchida K. et al., 2006, Clin Cancer Res  12 (18): 5417-22.
  • Kouno T. et al., 2008, J Pept Sci. 14 (10): 1129-38.
  • He H. et al., 2009, Cell Biochem Biophys 55 (3): 117-26.
  • Liu XG. et al., 2010, Oncol Rep. 23 (5): 1301-8.
  • S100A11 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    S100A11 cDNA ORF Clone in Cloning Vector, Rat RG80466-U
    S100A11 cDNA ORF Clone, Rat, untagged RG80466-UT
    S100A11 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80466-ACG
    S100A11 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80466-ACGLN
    S100A11 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80466-ANG
    S100A11 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80466-ACR
    S100A11 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80466-ANR
    S100A11 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80466-CF
    S100A11 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80466-NF
    S100A11 cDNA ORF Clone, Rat, C-His tag RG80466-CH
    S100A11 cDNA ORF Clone, Rat, N-His tag RG80466-NH
    S100A11 cDNA ORF Clone, Rat, C-HA tag RG80466-CY
    S100A11 cDNA ORF Clone, Rat, N-HA tag RG80466-NY
    S100A11 cDNA ORF Clone, Rat, C-Myc tag RG80466-CM
    S100A11 cDNA ORF Clone, Rat, N-Myc tag RG80466-NM
    S100A11 qPCR Primer Pairs, Rat RP300430

    S100A11 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    S100A11 cDNA ORF Clone in Cloning Vector, Mouse MG50227-M
    S100A11 cDNA ORF Clone, Mouse, untagged MG50227-UT
    S100A11 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50227-ACG
    S100A11 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50227-ACGLN
    S100A11 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50227-ANG
    S100A11 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50227-ACR
    S100A11 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50227-ANR
    S100A11 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50227-CF
    S100A11 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50227-NF
    S100A11 cDNA ORF Clone, Mouse, C-His tag MG50227-CH
    S100A11 cDNA ORF Clone, Mouse, N-His tag MG50227-NH
    S100A11 cDNA ORF Clone, Mouse, C-HA tag MG50227-CY
    S100A11 cDNA ORF Clone, Mouse, N-HA tag MG50227-NY
    S100A11 cDNA ORF Clone, Mouse, C-Myc tag MG50227-CM
    S100A11 cDNA ORF Clone, Mouse, N-Myc tag MG50227-NM
    S100A11 qPCR Primer Pairs, Mouse MP200254

    S100A11 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    S100A11 cDNA ORF Clone in Cloning Vector, Human HG11140-M
    S100A11 cDNA ORF Clone, Human, untagged HG11140-UT
    S100A11 cDNA ORF Clone, Human, C-GFPSpark® tag HG11140-ACG
    S100A11 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11140-ACGLN
    S100A11 cDNA ORF Clone, Human, N-GFPSpark® tag HG11140-ANG
    S100A11 cDNA ORF Clone, Human, C-OFPSpark® tag HG11140-ACR
    S100A11 cDNA ORF Clone, Human, N-OFPSpark® tag HG11140-ANR
    S100A11 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11140-CF
    S100A11 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11140-NF
    S100A11 cDNA ORF Clone, Human, C-His tag HG11140-CH
    S100A11 cDNA ORF Clone, Human, N-His tag HG11140-NH
    S100A11 cDNA ORF Clone, Human, N-HA tag HG11140-NY
    S100A11 cDNA ORF Clone, Human, C-Myc tag HG11140-CM
    S100A11 cDNA ORF Clone, Human, N-Myc tag HG11140-NM
    S100A11 qPCR Primer Pairs, Human HP101050
    info info
    添加购物车成功! 添加购物车失败!