S100A12 cDNA ORF Clone, Human, C-HA tag

Cat: HG11143-CY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All S100A12 Reagents

CRO Services

Product recommended


All S100A12 Reagents

S100A12 cDNA ORF Clone, Human, C-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
279 bp
Description
Full length Clone DNA of Human S100 calcium binding protein A5 with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

S100A12 cDNA ORF Clone, Human, C-HA tag Alternative Names

CAAF1 cDNA ORF Clone, Human;CAGC cDNA ORF Clone, Human;CGRP cDNA ORF Clone, Human;ENRAGE cDNA ORF Clone, Human;MRP-6 cDNA ORF Clone, Human;MRP6 cDNA ORF Clone, Human;p6 cDNA ORF Clone, Human;S100A12 cDNA ORF Clone, Human

S100A12 Background Information

S100 protein is a family of low molecular weight protein found in vertebrates characterized by two EF-hand calcium-binding motifs. There are at least 21 different S100 proteins, and the name is derived from the fact that the protein is 100% soluble in ammonium sulfate at neutral pH. Most S100 proteins are disulfide-linked homodimer, and is normally present in cells derived from the neural crest, chondrocytes, macrophages, dendritic cells, etc. S100 proteins have been implicated in a variety of intracellular and extracellular functions. They are involved in regulation of protein phosphorylation, transcription factors, the dynamics of cytoskeleton constituents, enzyme activities, cell growth and differentiation, and the inflammatory response. 

Protein S100-A12, also known as S100 calcium-binding protein A12, Calcium-binding protein in amniotic fluid 1, Calgranulin-C, and S100A12, is a member of the S-101 family. Like the majority of S100 proteins, S100A12 is a dimer, with the interface between the two subunits being composed mostly of hydrophobic residues. The fold of S100A12 is similar to the other known crystal and solution structures of S100 proteins, except for the linker region between the two EF-hand motifs. S100A12 plays an important role in the inflammatory response.

Full Name
S100 calcium binding protein A12
References
  • Moroz, OV. et al., 2001, Acta Crystallogr D Biol Crystallogr. 57: 20-9.
  • Foell, D. et al., 2003, Lancet  361 (9365):1270-2.
  • Vogl, T. et al., 2004, Blood. 104: 4260-8.
  • Viemann, D. et al., 2005, Blood. 105: 2955-62.
  • Nakatani, Y. et al., 2005, Mediators Inflamm. 2005: 280-292.
  • Bjoerk, P. et al., 2009, PLoS Biol. 7: E97-E97.
  • info info
    添加购物车成功! 添加购物车失败!