S100A5 cDNA ORF Clone, Human, C-HA tag

Cat: HG11142-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All S100A5 Reagents
CRO Services
Product recommended

All S100A5 Reagents
S100A5 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
333 bp
Description
Full length Clone DNA of Human S100 calcium binding protein A5 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

S100A5 cDNA ORF Clone, Human, C-HA tag Alternative Names
S100D cDNA ORF Clone, Human
S100A5 Background Information

S100 protein?is a family of low molecular weight protein found in vertebrates characterized by two?EF-hand calcium-binding motifs. There are at least 21 different S100 proteins, and the name is derived from the fact that the protein is?100%?soluble in ammonium sulfate?at neutral?pH. Most S100 proteins are disulfide-linked homodimer, and is normally present in cells derived from the?neural crest, chondrocytes, macrophages, dendritic cells, etc. S100 proteins have been implicated in a variety of intracellular and extracellular functions. They are involved in regulation of protein phosphorylation, transcription factors, the dynamics of cytoskeleton constituents, enzyme activities, cell growth and differentiation, and the inflammatory response.?? Protein S100-A5, also known as Protein S-100D, S100 calcium-binding protein A5, S100A5 and S100D, is a member of the S100 family which contains two?EF-hand domains. S100A5 is also a novel member of the EF-hand superfamily of calcium-binding proteins that is poorly characterized at the protein level. It is expressed in very restricted regions of the adult brain. From birth onwards, S100A5 remained a neuronal-specific protein, only located in a subpopulation of neurons in the spiral ganglion.

Full Name
S100 calcium binding protein A5
References
  • Sch?fer,B.W. et al., 2000, J Biol Chem. 275 (39):30623-30.
  • Gebhardt, C. et al., 2006, Biochem Pharmacol. 72 (11):1622-31.
  • Nonaka, D. et al., 2008, J. Cutan. Pathol. 35 (11): 1014-9.
  • Lim, SY. et al., 2008, J Immunol. 181 (8): 5627-36.
  • Heibeck TH. et al., 2009, J. Proteome Res. 8:3852-61.
  • S100A5 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    S100A5 cDNA ORF Clone in Cloning Vector, Mouse MG50427-M
    S100A5 cDNA ORF Clone, Mouse, untagged MG50427-UT
    S100A5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50427-ACGLN
    S100A5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50427-ACG
    S100A5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50427-ANG
    S100A5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50427-ACR
    S100A5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50427-ANR
    S100A5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50427-CF
    S100A5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50427-NF
    S100A5 cDNA ORF Clone, Mouse, C-His tag MG50427-CH
    S100A5 cDNA ORF Clone, Mouse, N-His tag MG50427-NH
    S100A5 cDNA ORF Clone, Mouse, C-HA tag MG50427-CY
    S100A5 cDNA ORF Clone, Mouse, N-HA tag MG50427-NY
    S100A5 cDNA ORF Clone, Mouse, C-Myc tag MG50427-CM
    S100A5 cDNA ORF Clone, Mouse, N-Myc tag MG50427-NM
    S100A5 qPCR Primer Pairs, Mouse MP200437

    S100A5 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    S100A5 cDNA ORF Clone in Cloning Vector, Human HG11142-M
    S100A5 cDNA ORF Clone, Human, untagged HG11142-UT
    S100A5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11142-ACGLN
    S100A5 cDNA ORF Clone, Human, C-GFPSpark® tag HG11142-ACG
    S100A5 cDNA ORF Clone, Human, N-GFPSpark® tag HG11142-ANG
    S100A5 cDNA ORF Clone, Human, C-OFPSpark® tag HG11142-ACR
    S100A5 cDNA ORF Clone, Human, N-OFPSpark® tag HG11142-ANR
    S100A5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11142-CF
    S100A5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11142-NF
    S100A5 cDNA ORF Clone, Human, C-His tag HG11142-CH
    S100A5 cDNA ORF Clone, Human, N-His tag HG11142-NH
    S100A5 cDNA ORF Clone, Human, N-HA tag HG11142-NY
    S100A5 cDNA ORF Clone, Human, C-Myc tag HG11142-CM
    S100A5 cDNA ORF Clone, Human, N-Myc tag HG11142-NM
    S100A5 qPCR Primer Pairs, Human HP101052
    info info
    添加购物车成功! 添加购物车失败!