After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 S100A8/MRP-8 Gene ORF cDNA clone expression plasmid, C-HA 태그

데이터시트리뷰관련제품프로토콜
Human S100A8 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_002964.3
cDNA 크기:282bp
cDNA 설명:Full length Clone DNA of Homo sapiens S100 calcium binding protein A8 with C terminal HA tag.
유전자 동의어:P8, MIF, NIF, CAGA, CFAG, CGLA, L1Ag, MRP8, CP-10, MA387, 60B8AG, S100A8
:Human
벡터:pCMV3-C-HA
Plasmid:pCMV3-S100A8-HA
제한 사이트:KpnI + XbaI (6kb + 0.32kb)
태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Human S100A8 Gene Plasmid Map
Human S100A8 natural ORF mammalian expression plasmid, C-HA tag
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
연구배경

S100A8 is a member of the S100 protein family containing 2EF-hand calcium-binding motifs. S100 proteins are involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. Altered expression of S100A8 protein is associated with various diseases and cancers. S100A8 may have an immunoregulatory role by contributing to the regulation of fetal-maternal interactions. It may play a protective role and its absence may allow infiltration by maternal cells, a process eventually manifesting as resorption. The heterodimeric S100 protein complex S100A8/A9 which has been shown to be involved in inflammatory and neoplastic disorders. The complex can induce cell proliferation, or apoptosis, inflammation, collagen synthesis, and cell migration. S100A8/A9 has emerged as important pro-inflammatory mediator in acute and chronic inflammation. More recently, increased S100A8 and S100A9 levels were also detected in various human cancers, presenting abundant expression in neoplastic tumor cells as well as infiltrating immune cells. On the one hand, S100A8/A9 is a powerful apoptotic agent produced by immune cells, making it a very fascinating tool in the battle against cancer. It spears the risk to induce auto-immune response and may serve as a lead compound for cancer-selective therapeutics. In contrast, S100A8/A9 expression in cancer cells has also been associated with tumor development, cancer invasion or metastasis. Altogether, its expression and potential cytokine-like function in inflammation and in cancer suggests that S100A8/A9 may play a key role in inflammation-associated cancer.

참고자료
  • Passey RJ, et al. (1999) S100A8: emerging functions and regulation. J Leukoc Biol. 66(4): 549-56.
  • Gebhardt C, et al. (2006) S100A8 and S100A9 in inflammation and cancer. Biochem Pharmacol. 72(11): 1622-31.
  • Halayko AJ, et al. (2009) S100A8/A9: a mediator of severe asthma pathogenesis and morbidity? Can J Physiol Pharmacol. 87(10): 743-55.
  • Ghavami S, et al. (2009) S100A8/A9: a Janus-faced molecule in cancer therapy and tumorgenesis. Eur J Pharmacol. 625(1-3): 73-83.
  • Ha YS, et al. (2010) mRNA Expression of S100A8 as a Prognostic Marker for Progression of Non-Muscle-Invasive Bladder Cancer. Korean J Urol. 51(1): 15-20.
  • Size / Price
    Cat No: HG11138-CY
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보In Stock
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
    • Human S100A8 natural ORF mammalian expression plasmid, C-HA tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".