After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 SAE1 Gene ORF cDNA clone expression plasmid, C-Flag 태그

데이터시트리뷰관련제품프로토콜
Human SAE1 cDNA 클론 제품 정보
Gene_bank_ref_id:BC000344
cDNA 크기:1041bp
cDNA 설명:Full length Clone DNA of Homo sapiens SUMO1 activating enzyme subunit 1 with C terminal Flag tag.
유전자 동의어:AOS1, SUA1, UBLE1A, HSPC140
:Human
벡터:pCMV3-C-FLAG
Plasmid:
제한 사이트:
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
연구배경

SAE1 belongs to the ubiquitin-activating E1 family. It is a heterodimer that acts as a E1 ligase for SUMO1, SUMO2, SUMO3, and probably SUMO4. It functions as a UBLI E1 ligase mediating the ATP-dependent activation of UBL1. SAE1 binds with UBLE1A and UBLE1B to form a heterodimer which can bind UBL1. SAE1 also regulates ATP-dependent activation of SUMO proteins and formation of a thioester with a conserved cysteine residue on SAE2. SAE1 and UBA2 form a heterodimer that functions as a SUMO-activating enzyme for the sumoylation of proteins.

참고자료
  • Gong L, et al. (1999) Molecular cloning and characterization of human AOS1 and UBA2, components of the sentrin-activating enzyme complex. FEBS Lett. 448(1):185-9.
  • Lois LM, et al. (2005) Structures of the SUMO E1 provide mechanistic insights into SUMO activation and E2 recruitment to E1. EMBO J. 24(3):439-51.
  • Tatham MH, et al. (2001) Polymeric chains of SUMO-2 and SUMO-3 are conjugated to protein substrates by SAE1/SAE2 and Ubc9. J Biol Chem. 276(38):35368-74.
  • Size / Price
    Cat No: HG13921-CF
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".