After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 KITLG/SCF/C-kit ligand Gene ORF cDNA clone expression plasmid, C-His 태그

데이터시트리뷰관련제품프로토콜
Human KITLG cDNA 클론 제품 정보
Gene_bank_ref_id:NM_000899.3
cDNA 크기:822bp
cDNA 설명:Full length Clone DNA of Homo sapiens KIT ligand with C terminal His tag.
유전자 동의어:SF, MGF, SCF, KL-1, Kitl, SHEP7, DKFZp686F2250, KITLG
:Human
벡터:pCMV3-C-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
연구배경

Similar to Kit ligand precursor (C-kit ligand) , also known as Stem cell factor (SCF), Mast cell growth factor (MGF) or Hematopoietic growth factor KL. SCF/C-kit ligand is the ligand of the tyrosine-kinase receptor encoded by the KIT locus. This ligand is a pleiotropic factor that acts in utero in germ cell and neural cell development, and hematopoiesis, all believed to reflect a role in cell migration. In adults, it functions pleiotropically, while mostly noted for its continued requirement in hematopoiesis. SCF/C-kit ligand stimulates the proliferation of mast cells. This protein is able to augment the proliferation of both myeloid and lymphoid hematopoietic progenitors in bone marrow culture. It may act synergistically with other cytokines, probably interleukins SCF/C-kit ligand is the ligand for the tyrosine kinase receptor c-kit, which is expressed on both primitive and mature hematopoietic progenitor cells. In vitro, SCF/C-kit ligand synergizes with other growth factors, such as granulocyte colony-stimulating factor (G-CSF), granulocyte macrophage- colony- stimulating factor, and interleukin-3 to stimulate the proliferation and differentiation of cells of the lymphoid, myeloid, erythroid, and megakaryocytic lineages. In vivo, SCF/C-kit also synergizes with other growth factors and has been shown to enhance the mobilization of peripheral blood progenitor cells in combination with G-CSF. In phase I/II clinical studies administration of the combination of SCF and G-CSF resulted in a two- to threefold increase in cells that express the CD34 antigen compared with G-CSF alone.

참고자료
  • McNiece IK, et al. (1995) Stem cell factor. J Leukoc Biol. 58(1): 14-22.
  • Besmer P, et al. (1993) The kit-ligand (steel factor) and its receptor c-kit/W: pleiotropic roles in gametogenesis and melanogenesis. Dev Suppl. 1993:125-37.
  • Mekori YA, et al. (1993) IL-3-dependent murine mast cells undergo apoptosis on removal of IL-3. Prevention of apoptosis by c-kit ligand. J Immunol. 151(7): 3775-84.
  • Size / Price
    Cat No: HG10451-CH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".