After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

휴먼 SCLY / Selenocysteine Lyase Gene ORF cDNA clone expression plasmid, N-Myc 태그

데이터시트리뷰관련제품프로토콜
Human SCLY cDNA 클론 제품 정보
Gene_bank_ref_id:BC007891
cDNA 크기:1338bp
cDNA 설명:Full length Clone DNA of Homo sapiens selenocysteine lyase with N terminal Myc tag.
유전자 동의어:SCL, hSCL
:Human
벡터:pCMV3-N-Myc
Plasmid:
제한 사이트:
태그 씨퀀스:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

휴먼 SCLY / Selenocysteine Lyase Gene ORF cDNA clone expression plasmid, N-Myc 태그 on other vectors
휴먼 SCLY / Selenocysteine Lyase Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG14905-ACG265260
휴먼 SCLY / Selenocysteine Lyase Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG14905-ACR265260
휴먼 SCLY / Selenocysteine Lyase Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG14905-ANG265260
휴먼 SCLY / Selenocysteine Lyase Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG14905-ANR265260
휴먼 SCLY / Selenocysteine Lyase Gene ORF cDNA clone expression plasmid, C-Flag 태그HG14905-CF229890
휴먼 SCLY / Selenocysteine Lyase Gene ORF cDNA clone expression plasmid, C-His 태그HG14905-CH229890
휴먼 SCLY / Selenocysteine Lyase Gene ORF cDNA clone expression plasmid, C-Myc 태그HG14905-CM229890
휴먼 SCLY / Selenocysteine Lyase Gene ORF cDNA clone expression plasmid, C-HA 태그HG14905-CY229890
휴먼 SCLY / Selenocysteine Lyase Gene ORF cDNA clone in cloning vectorHG14905-G88420
휴먼 SCLY / Selenocysteine Lyase Gene ORF cDNA clone expression plasmid, N-Flag 태그HG14905-NF229890
휴먼 SCLY / Selenocysteine Lyase Gene ORF cDNA clone expression plasmid, N-His 태그HG14905-NH229890
휴먼 SCLY / Selenocysteine Lyase Gene ORF cDNA clone expression plasmid, N-Myc 태그HG14905-NM229890
휴먼 SCLY / Selenocysteine Lyase Gene ORF cDNA clone expression plasmid, N-HA 태그HG14905-NY229890
휴먼 SCLY / Selenocysteine Lyase Gene ORF cDNA clone expression plasmidHG14905-UT229890
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

SCLY, also known as selenocysteine lyase, belongs to the class-V pyridoxal-phosphate-dependent aminotransferase family. It is a novel enzyme that exclusively decomposes L-selenocysteine into L-alanine and H2Se in various mammalian tissues. SCLY contains pyridoxal 5'-phosphate and weighs approximately 85,000. SCLY participates in selenoamino acid metabolism. It employs one cofactor, pyridoxal phosphate. Its maximum reactivity is at about pH 9.0. It was shown that 1 mol of selenocysteine is converted to equimolar amounts of alanine and H2Se. The following amino acids are insert: L-cysteine, L-serine, L-cysteine sulfinate, selenocysteamine, Se-ethyl-DL-selenocysteine, and L-selenohomocysteine. L-Cysteine (Ki, 1.0 mM) competes with L-selenocysteine (Km, 0.83mM) to inhibit the enzyme reaction.

참고자료
  • Johansson AL. et al., 2012, PLoS One. 7 (1): e30528.
  • Collins R. et al., 2012, PLoS One. 7 (1): e30581.
  • N Esaki. et al., 1982, The Journal of Biological Chemistry. 257: 4386-91.
  • Size / Price
    Cat No: HG14905-NM
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".