SDHD cDNA ORF Clone, Human, C-His tag

Cat: HG14001-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All SDHD Reagents

CRO Services

Product recommended


All SDHD Reagents

SDHD cDNA ORF Clone, Human, C-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
480 bp
Description
Full length Clone DNA of Human succinate dehydrogenase complex, subunit D, integral membrane protein with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SDHD cDNA ORF Clone, Human, C-His tag Alternative Names

CBT1 cDNA ORF Clone, Human;CII-4 cDNA ORF Clone, Human;CWS3 cDNA ORF Clone, Human;cybS cDNA ORF Clone, Human;PGL cDNA ORF Clone, Human;PGL1 cDNA ORF Clone, Human;QPs3 cDNA ORF Clone, Human;SDH4 cDNA ORF Clone, Human

SDHD Background Information

Full Name
succinate dehydrogenase complex, subunit D, integral membrane protein

SDHD cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
SDHD cDNA ORF Clone in Cloning Vector, Canine DG70252-U
SDHD cDNA ORF Clone, Canine, untagged DG70252-UT
SDHD cDNA ORF Clone, Canine, C-GFPSpark® tag DG70252-ACG
SDHD Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70252-ACGLN
SDHD cDNA ORF Clone, Canine, N-GFPSpark® tag DG70252-ANG
SDHD cDNA ORF Clone, Canine, C-OFPSpark® tag DG70252-ACR
SDHD cDNA ORF Clone, Canine, N-OFPSpark® tag DG70252-ANR
SDHD cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70252-CF
SDHD cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70252-NF
SDHD cDNA ORF Clone, Canine, C-His tag DG70252-CH
SDHD cDNA ORF Clone, Canine, N-His tag DG70252-NH
SDHD cDNA ORF Clone, Canine, C-HA tag DG70252-CY
SDHD cDNA ORF Clone, Canine, N-HA tag DG70252-NY
SDHD cDNA ORF Clone, Canine, C-Myc tag DG70252-CM
SDHD cDNA ORF Clone, Canine, N-Myc tag DG70252-NM

SDHD cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SDHD cDNA ORF Clone in Cloning Vector, Mouse MG52499-U
SDHD cDNA ORF Clone, Mouse, untagged MG52499-UT
SDHD Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52499-ACGLN
SDHD cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52499-ACG
SDHD cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52499-ANG
SDHD cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52499-ACR
SDHD cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52499-ANR
SDHD cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52499-CF
SDHD cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52499-NF
SDHD cDNA ORF Clone, Mouse, C-His tag MG52499-CH
SDHD cDNA ORF Clone, Mouse, N-His tag MG52499-NH
SDHD cDNA ORF Clone, Mouse, C-HA tag MG52499-CY
SDHD cDNA ORF Clone, Mouse, N-HA tag MG52499-NY
SDHD cDNA ORF Clone, Mouse, C-Myc tag MG52499-CM
SDHD cDNA ORF Clone, Mouse, N-Myc tag MG52499-NM
SDHD qPCR Primer Pairs, Mouse MP202372

SDHD cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SDHD cDNA ORF Clone in Cloning Vector, Human HG14001-G
SDHD cDNA ORF Clone, Human, untagged HG14001-UT
SDHD cDNA ORF Clone, Human, C-GFPSpark® tag HG14001-ACG
SDHD Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14001-ACGLN
SDHD cDNA ORF Clone, Human, N-GFPSpark® tag HG14001-ANG
SDHD cDNA ORF Clone, Human, C-OFPSpark® tag HG14001-ACR
SDHD cDNA ORF Clone, Human, N-OFPSpark® tag HG14001-ANR
SDHD cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14001-CF
SDHD cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14001-NF
SDHD cDNA ORF Clone, Human, N-His tag HG14001-NH
SDHD cDNA ORF Clone, Human, C-HA tag HG14001-CY
SDHD cDNA ORF Clone, Human, N-HA tag HG14001-NY
SDHD cDNA ORF Clone, Human, C-Myc tag HG14001-CM
SDHD cDNA ORF Clone, Human, N-Myc tag HG14001-NM
SDHD qPCR Primer Pairs, Human HP102657
info info
添加购物车成功! 添加购物车失败!