After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 SerpinA10 Gene ORF cDNA clone expression plasmid, C-Flag 태그

데이터시트리뷰관련제품프로토콜
Human SERPINA10 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_001100607.1
cDNA 크기:1335bp
cDNA 설명:Full length Clone DNA of Homo sapiens serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10 with C terminal Flag tag.
유전자 동의어:PZI, ZPI
:Human
벡터:pCMV3-C-FLAG
Plasmid:pCMV3-SERPINA10-flag
제한 사이트:HindIII + XbaI (6kb + 1.37kb)
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Human SERPINA10 Gene Plasmid Map
Human SERPINA10 ORF mammalian expression plasmid, C-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
연구배경

Mouse protein Z-dependent protease inhibitor, also known as PZ-dependent protease inhibitor, SERPINA10 and ZPI, is a secreted protein which belongs to the serpin family. It is expressed by the liver and secreted in plasma. SERPINA10 / Serpin-A10 inhibits factor Xa activity in the presence of protein Z, calcium and phospholipid. Serpins are a group of proteins with similar structures that were first identified as a set of proteins able to inhibit proteases. The acronym serpin was originally coined because many serpins inhibit chymotrypsin-like serine proteases (serine protease inhibitors).Over 1000 serpins have now been identified, these include 36 human proteins, as well as molecules in plants, fungi, bacteria, archaea and certain viruses. Serpins are the largest and most diverse family of protease inhibitors. Most serpins control proteolytic cascades, certain serpins do not inhibit enzymes, but instead perform diverse functions such as storage (ovalbumin, in egg white), hormone carriage proteins (thyroxine-binding globulin, cortisol-binding globulin) and tumor suppressor genes (maspin). Most inhibitory serpins target chymotrypsin-like serine proteases. These enzymes are defined by the presence of a nucleophilic serine residue in their catalytic site. Some serpins inhibit other classes of protease. A number of such serpins have been shown to target cysteine proteases. These enzymes differ from serine proteases in that they are defined by the presence of a nucleophilic cysteine residue, rather than a serine residue, in their catalytic site.

참고자료
  • Han X, et al., 1998, Proc Natl Acad Sci. USA  95: 9250-5.
  • Han X, et al., 2000, Blood 96: 3049-55.
  • Irving JA, et al.,2000, Genome Res. 10 (12): 1845-64.
  • Irving J, et al.,2002, Mol Biol Evol. 19 (11): 1881-90.
  • Rawlings ND, et al.,2004, Biochem J. 378 (Pt 3): 705-16.
  • Water N, et al., 2004, Br J Haematol. 127:190-4.
  • Wei Z, et al., 2009, Blood 114 (17): 3662-7.
  • Whisstock JC, et al.,2010, J Biol Chem. 285 (32): 24307-12.
  • Size / Price
    Cat No: HG10992-CF
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보In Stock
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
    • Human SERPINA10 ORF mammalian expression plasmid, C-Flag tag
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".