After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

휴먼 PEDF Gene ORF cDNA clone expression plasmid, C-His 태그

데이터시트리뷰관련제품프로토콜
Human SERPINF1 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_002615.4
cDNA 크기:1257bp
cDNA 설명:Full length Clone DNA of Homo sapiens serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1 with C terminal His tag.
유전자 동의어:PEDF, EPC-1, PIG35
:Human
벡터:pCMV3-C-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
연구배경

Pigment epithelium-derived factor, also known as PEDF, Serpin F1, and SERPINF1, is a multiple functional protein which has both anti-angiogenic activity and neurotrophic activity at the same time. PEDF is a secreted glycoprotein that belongs to the noninhibitory serpin. It has an alpha/beta core serine-protease inhibitor domain, three major beta-sheets, and ten alpha-helices. PEDF does not inhibit either serine or cysteine proteinases. PEDF exerts diverse physiological activities including anti-angiogenesis, anti-vasopermeability, anti-tumor, and neurotrophic activities. PEDF acts via multiple high affinity ligands and cell receptors. It has been described as a natural angiogenesis inhibitor with neurotrophic and immune-modulation properties. PEDF induces macrophages apoptosis and necrosis through the activation of peroxisome proliferator-activated receptor-gamma by which PEDF could modulate inflammatory reactions in septic shock. It balances angiogenesis in the eye and blocks tumor progression.

참고자료
  • Ren, JG. et al., 2005, Med Hypotheses. 64 (1): 74-8.
  • Filleur, S. et al., 2009. J Cell Biochem. 106 (5): 769-75.
  • Kawaguchi, T. et al., 2010, Curr Mol Med. 10 (3): 302-11.
  • Yamagishi, SI. et al., 2010, Curr Mol Med. 10 (3): 284-91.
  • Nakamura, T. et al., 2010, Curr Mol Med. 10 (3): 312-6.
  • Size / Price
    Cat No: HG11104-CH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".