휴먼 SH2D1A Gene ORF cDNA clone expression plasmid, C-HA 태그

    데이터시트리뷰관련제품프로토콜
    휴먼 SH2D1A cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_002351.3
    cDNA 크기:387bp
    cDNA 설명:Full length Clone DNA of Homo sapiens SH2 domain protein 1A with C terminal HA tag.
    유전자 동의어:LYP, SAP, XLP, DSHP, EBVS, IMD5, XLPD, MTCP1, FLJ18687, FLJ92177, SH2D1A
    :Human
    벡터:pCMV3-C-HA
    Plasmid:
    제한 사이트:
    태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SH2D1A qPCR primers for gene expression analysis, HP101058 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    연구배경

    SH2 domain-containing protein 1A (SH2D1A / SAP) is a 128 amino acid protein, containing a single Src homology 2 (SH2) domain, flanked by 5 amino acids at the N-terminus and 25 amino acids at the C-terminus. The absence of a catalytic domain and the presence of an SH2 domain suggest that SH2D1A regulates one or more signal transduction pathways. SH2D1A interacts with signaling lymphocytic activation molecule (SLAM), which is a transmembrane protein expressed on the surface of activated T and B cells. SH2D1A (SAP) interacts via its SH2 domain with a motif (TIYXXV) present in the cytoplasmic tail of the cell-surface receptors, including CD150 / SLAM, CD84, CD229 / Ly-9, and CD244 / 2B4. SH2D1A was expressed in EBV-carrying, tumor phenotype representative (type I), but not in EBV-carrying lymphoblastoid cell line (LCL)-like (type III) or EBV-negative Burkitt lymphoma (BL) lines. It has been supposed to be related to the X-linked lymphoproliferative disease which is also known as Duncan's disease or Purtilo syndrome. 

    참고자료
  • Morra M, et al. (2005) Defective B cell responses in the absence of SH2D1A. PNAS. 102 (13): 4819-23.
  • Morra M, et al. (2001) Characterization of SH2D1A Missense Mutations Identified in X-linked Lymphoproliferative Disease Patients. The Journal of Biological Chemistry. 276: 36809-16.
  • Hron JD, et al. (2004) SH2D1A Regulates T-dependent Humoral Autoimmunity. JEM. 200 (2): 261-6.
  • Size / Price
    Cat No: HG11149-CY
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".