SHMT2 cDNA ORF Clone, Human, C-HA tag

Cat: HG13426-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SHMT2 Reagents
CRO Services
Product recommended

All SHMT2 Reagents
SHMT2 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1557 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human serine hydroxymethyltransferase 2 (mitochondrial) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Restriction Sites
KpnI + XbaI(6kb+1.56kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
SHMT2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SHMT2 cDNA ORF Clone, Human, C-HA tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5612
SHMT2 cDNA ORF Clone, Human, C-HA tag Alternative Names
GLYA cDNA ORF Clone, Human;HEL-S-51e cDNA ORF Clone, Human;SHMT cDNA ORF Clone, Human
SHMT2 Background Information
Full Name
serine hydroxymethyltransferase 2 (mitochondrial)

SHMT2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SHMT2 cDNA ORF Clone in Cloning Vector, Mouse MG51630-G
SHMT2 cDNA ORF Clone, Mouse, untagged MG51630-UT
SHMT2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51630-ACG
SHMT2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51630-ACGLN
SHMT2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51630-ANG
SHMT2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51630-ACR
SHMT2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51630-ANR
SHMT2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51630-CF
SHMT2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51630-NF
SHMT2 cDNA ORF Clone, Mouse, C-His tag MG51630-CH
SHMT2 cDNA ORF Clone, Mouse, N-His tag MG51630-NH
SHMT2 cDNA ORF Clone, Mouse, C-HA tag MG51630-CY
SHMT2 cDNA ORF Clone, Mouse, N-HA tag MG51630-NY
SHMT2 cDNA ORF Clone, Mouse, C-Myc tag MG51630-CM
SHMT2 cDNA ORF Clone, Mouse, N-Myc tag MG51630-NM
SHMT2 qPCR Primer Pairs, Mouse MP201503

SHMT2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SHMT2 cDNA ORF Clone in Cloning Vector, Human HG13426-G
SHMT2 cDNA ORF Clone, Human, untagged HG13426-UT
SHMT2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13426-ACGLN
SHMT2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13426-ACG
SHMT2 cDNA ORF Clone, Human, N-GFPSpark® tag HG13426-ANG
SHMT2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13426-ACR
SHMT2 cDNA ORF Clone, Human, N-OFPSpark® tag HG13426-ANR
SHMT2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13426-CF
SHMT2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13426-NF
SHMT2 cDNA ORF Clone, Human, C-His tag HG13426-CH
SHMT2 cDNA ORF Clone, Human, N-His tag HG13426-NH
SHMT2 cDNA ORF Clone, Human, N-HA tag HG13426-NY
SHMT2 cDNA ORF Clone, Human, C-Myc tag HG13426-CM
SHMT2 cDNA ORF Clone, Human, N-Myc tag HG13426-NM
SHMT2 qPCR Primer Pairs, Human HP102128
info info
添加购物车成功! 添加购物车失败!