휴먼 SMAC/Diablo transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag 태그

    데이터시트리뷰관련제품프로토콜
    휴먼 DIABLO cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_019887.3
    cDNA 크기:720bp
    cDNA 설명:Full length Clone DNA of Homo sapiens diablo homolog (Drosophila), nuclear gene encoding mitochondrial protein, transcript variant 1 with C terminal Flag tag.
    유전자 동의어:SMAC, SMAC3, DIABLO-S, FLJ10537, FLJ25049
    :Human
    벡터:pCMV3-C-FLAG
    Plasmid:
    제한 사이트:
    태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with DIABLO qPCR primers for gene expression analysis, HP100033 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    휴먼 SMAC/Diablo transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag 태그 on other vectors
    휴먼 SMAC/Diablo transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG10339-ACG265260
    휴먼 SMAC/Diablo transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG10339-ACR265260
    휴먼 SMAC/Diablo transcript variant 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG10339-ANG265260
    휴먼 SMAC/Diablo transcript variant 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG10339-ANR265260
    휴먼 SMAC/Diablo transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG10339-CF229890
    휴먼 SMAC/Diablo transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His 태그HG10339-CH229890
    휴먼 SMAC/Diablo transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc 태그HG10339-CM229890
    휴먼 SMAC/Diablo transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA 태그HG10339-CY229890
    휴먼 SMAC/Diablo transcript variant 1 Gene ORF cDNA clone in cloning vectorHG10339-M88420
    휴먼 SMAC/Diablo transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG10339-M-F229890
    휴먼 SMAC/Diablo transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag 태그HG10339-NF229890
    휴먼 SMAC/Diablo transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His 태그HG10339-NH229890
    휴먼 SMAC/Diablo transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc 태그HG10339-NM229890
    휴먼 SMAC/Diablo transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA 태그HG10339-NY229890
    휴먼 SMAC/Diablo transcript variant 1 Gene ORF cDNA clone expression plasmidHG10339-UT229890
     발현 벡터에 대해 자세히 알아보기
    Product nameProduct name
    연구배경

    Apoptosis is an essential processes required for normal development and homeostasis of all metazoan organisms. Second Mitochondria-Derived Activator of Caspases (Smac) or Direct IAP Binding Protein with low isoelectric point, pI (Diablo) is a proapoptogenic mitochondrial protein that is released to the cytosol in response to diverse apoptotic stimuli, including commonly used chemotherapeutic drugs. The current knowlege about structure and function of Smac/Diablo during programmed cell death, both in mitochondrial and receptor pathways are presented. It has been shown that Diablo mainly interacts with IAPs in the cytochrome c/Apaf-1/caspase-9 pathway, and promotes apoptosis. Diablo is released from the mitochondria into the cytosol occurring downstream of cytochrome c release in response to apoptotic stimuli such as irradiation, DNA damage or cytotoxic drugs. In the cytosol, Smac/Diablo interacts and antagonizes inhibitors of apoptosis proteins (IAPs), thus allowing the activation of caspases and apoptosis. This activity has prompted the synthesis of peptidomimetics that could potentially be used in cancer therapy. The role of Smac/DIABLO in colorectal carcinogenesis is ill defined. Data continues to accumulate to suggest that decreased levels of Smac/DIABLO may be important in chemoradiation-resistance to apoptosis in advanced colon cancer.

    참고자료
  • Korga A, et al. (2006) Role of mitochondrial protein Smac/Diablo in regulation of apoptotic pathways Pol Merkur Lekarski. 20(119): 573-6.
  • Anguiano-Hernandez YM, et al. (2007) Smac/DIABLO and colon cancer. Anticancer Agents Med Chem. 7(4): 467-73.
  • Martinez-Ruiz G, et al. (2008) Role of Smac/DIABLO in cancer progression. J Exp Clin Cancer Res. 27: 48.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".