After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 SMYD3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Flag 태그

데이터시트리뷰관련제품프로토콜
Human SMYD3 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_022743.1
cDNA 크기:1110bp
cDNA 설명:Full length Clone DNA of Homo sapiens SET and MYND domain containing 3 transcript variant 2 with N terminal Flag tag.
유전자 동의어:RIZ, KMT8, RIZ1, RIZ2, MTB-ZF, HUMHOXY1, PRDM2
:Human
벡터:pCMV3-N-FLAG
Plasmid:pCMV3-Flag-SMYD3
제한 사이트:KpnI + XbaI (6kb + 1.15kb)
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Human SMYD3 Gene Plasmid Map
Human SMYD3 transcript variant 2 natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

휴먼 SMYD3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Flag 태그 on other vectors
휴먼 SMYD3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG11217-ACG265260
휴먼 SMYD3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG11217-ACR265260
휴먼 SMYD3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG11217-ANG265260
휴먼 SMYD3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG11217-ANR265260
휴먼 SMYD3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG11217-CF229890
휴먼 SMYD3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-His 태그HG11217-CH229890
휴먼 SMYD3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Myc 태그HG11217-CM229890
휴먼 SMYD3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-HA 태그HG11217-CY229890
휴먼 SMYD3 transcript variant 2 Gene ORF cDNA clone in cloning vectorHG11217-M88420
휴먼 SMYD3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Flag 태그HG11217-NF229890
휴먼 SMYD3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-His 태그HG11217-NH229890
휴먼 SMYD3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Myc 태그HG11217-NM229890
휴먼 SMYD3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-HA 태그HG11217-NY229890
휴먼 SMYD3 transcript variant 2 Gene ORF cDNA clone expression plasmidHG11217-UT229890
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

SET and MYND domain-containing protein 3, also known as Zinc finger MYND domain-containing protein 1, SMYD3, and ZMYND, is a member of the histone-lysine methyltransferase family. SMYD3 contains one MYND-type zinc finger and one SET domain. SMYD3 is a histone H3 lysine-4-specific methyltransferase. It is expressed in skeletal muscles and testis. It is overexpressed in a majority of colorectal carcinoma (CRC) and hepatocellular carcinoma (HCC). SMYD3 plays an important role in transcriptional regulation in human carcinogenesis. It activates the transcription of a set of downstream genes. Of these downstream genes, there are several oncogenes and genes associated with cell adhesion (including those of N-Myc, CrkL, Wnt10b, L-selectin, CD31 and galectin-4), which have been shown to have effects on cell viability, adhesion, migration and metastasis. Increased SMYD3 expression is essential for the proliferation of breast cancer cells. SMYD3 may be a promising new target of therapeutic intervention for the treatment of cancers or other pathological processes associated with cell adhesion and migration.

참고자료
  • Hamamoto, R. et al., 2006, Cancer Sci. 97 (2): 113-8.
  • Luo, XG. et al., 2007, J Biosci Bioeng. 103 (5): 444-50.
  • Wang, XQ. et al., 2007, Exp Oncol. 29 (1): 71-3.
  • Silva, FP. et al., 2008, Oncogene. 27 (19): 2686-92.
  • Size / Price
    Cat No: HG11217-NF
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보In Stock
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
    • Human SMYD3 transcript variant 2 natural ORF mammalian expression plasmid, N-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".