휴먼 SNAI2 / Snail2 / slug Gene ORF cDNA clone expression plasmid

  • Human SNAI2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
데이터시트리뷰관련제품프로토콜
휴먼 SNAI2 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_003068.3
cDNA 크기:807bp
cDNA 설명:Full length Clone DNA of Homo sapiens snail homolog 2 (Drosophila).
유전자 동의어:SLUG, WS2D, SLUGH1, MGC10182, SNAI2
:Human
벡터:pCMV3-untagged
Plasmid:pCMV3-SNAI2
제한 사이트:KpnI + NotI (6.1kb + 0.81kb)
태그 씨퀀스:
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with SNAI2 qPCR primers for gene expression analysis, HP101101 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
휴먼 SNAI2 Gene Plasmid Map
Human SNAI2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
휴먼 SNAI2 / Snail2 / slug Gene ORF cDNA clone expression plasmid on other vectors
휴먼 SNAI2 / Snail2 / slug Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG11196-ACG265260
휴먼 SNAI2 / Snail2 / slug Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG11196-ACR265260
휴먼 SNAI2 / Snail2 / slug Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG11196-ANG265260
휴먼 SNAI2 / Snail2 / slug Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG11196-ANR265260
휴먼 SNAI2 / Snail2 / slug Gene ORF cDNA clone expression plasmid, C-Flag 태그HG11196-CF229890
휴먼 SNAI2 / Snail2 / slug Gene ORF cDNA clone expression plasmid, C-His 태그HG11196-CH229890
휴먼 SNAI2 / Snail2 / slug Gene ORF cDNA clone expression plasmid, C-Myc 태그HG11196-CM229890
휴먼 SNAI2 / Snail2 / slug Gene ORF cDNA clone expression plasmid, C-HA 태그HG11196-CY229890
휴먼 SNAI2 / Snail2 / slug Gene ORF cDNA clone in cloning vectorHG11196-M88420
휴먼 SNAI2 / Snail2 / slug Gene ORF cDNA clone expression plasmid, C-Flag 태그HG11196-M-F229890
휴먼 SNAI2 / Snail2 / slug Gene ORF cDNA clone expression plasmid, N-Flag 태그HG11196-NF229890
휴먼 SNAI2 / Snail2 / slug Gene ORF cDNA clone expression plasmid, N-His 태그HG11196-NH229890
휴먼 SNAI2 / Snail2 / slug Gene ORF cDNA clone expression plasmid, N-Myc 태그HG11196-NM229890
휴먼 SNAI2 / Snail2 / slug Gene ORF cDNA clone expression plasmid, N-HA 태그HG11196-NY229890
휴먼 SNAI2 / Snail2 / slug Gene ORF cDNA clone expression plasmidHG11196-UT229890
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
Size / Price
Cat No: HG11196-UT
정가: 
가격:      (You Save: )

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".