Text Size:AAA

휴먼 SOD2 Gene ORF cDNA clone expression plasmid, N-Flag 태그

데이터시트리뷰관련제품프로토콜
Human SOD2 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_000636
cDNA 크기:669bp
cDNA 설명:Full length Clone DNA of Homo sapiens superoxide dismutase 2, mitochondrial with N terminal Flag tag.
유전자 동의어:SOD2
:Human
벡터:pCMV3-N-FLAG
Plasmid:pCMV3-Flag-SOD2
제한 사이트:KpnI + XbaI (6kb + 0.71kb)
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Human SOD2 Gene Plasmid Map
Human SOD2 natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
연구배경

Superoxide dismutases (SOD) are important anti-oxidant enzymes that guard against superoxide toxicity. In humans, as in all mammals and most chordates, three forms of superoxide dismutase (SOD) are present: SOD1 is located in the cytoplasm, SOD2 in the mitochondria, and SOD3 is extracellular. Mitochondrial superoxide dismutase [SOD; manganese SOD (MnSOD) or SOD2] neutralizes highly reactive superoxide radical (O(

참고자료
  • Culotta VC, et al. (2006) Activation of superoxide dismutases: putting the metal to the pedal. Biochim Biophys Acta. 1763(7): 747-58.
  • Bag A, et al. (2008) Target sequence polymorphism of human manganese superoxide dismutase gene and its association with cancer risk: a review. Cancer Epidemiol Biomarkers Prev. 17(12): 3298-305.
  • Diehl C, et al. (2009) The basis of topical superoxide dismutase antipruritic activity. Acta Dermatovenerol Croat. 17(1): 25-39.
  • Ma X, et al. (2010) No association between SOD2 Val16Ala polymorphism and breast cancer susceptibility: a meta-analysis based on 9,710 cases and 11,041 controls. Breast Cancer Res Treat. 122(2): 509-14.
  • Size / Price
    Cat No: HG12061-NF
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보In Stock
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
    • Human SOD2 natural ORF mammalian expression plasmid, N-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".