After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

Human SPG21 transcript variant 1 ORF mammalian expression plasmid, N-HA tag

데이터시트리뷰관련제품프로토콜
Human SPG21 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_016630.3
cDNA 크기:927bp
cDNA 설명:Full length Clone DNA of Homo sapiens spastic paraplegia 21 (autosomal recessive, Mast syndrome), transcript variant 1 with N terminal HA tag.
유전자 동의어:MAST, ACP33, GL010, BM-019, MASPARDIN
:Human
벡터:pCMV3-N-HA
Plasmid:
제한 사이트:
태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human SPG21 transcript variant 1 ORF mammalian expression plasmid, N-HA tag on other vectors
Product nameProduct name
연구배경

Spastic paraplegia 21 (SPG21), also known as acid Cluster Protein 33 (ACP33) and Mast syndrome protein, is a member of the AB hydrolase superfamily. Human SPG21 is a 308 amino acid residue protein widely expressed in all tissues, including heart, brain, placenta, lung, liver, skeletal muscle, kidney and pancreas. SPG21 binds to the hydrophobic C-terminal amino acids of CD4 which are involved in repression of T cell activation via the noncatalytic alpha/beta hydrolase fold domain. SPG21 thus is proposed to play a role as a negative regulatory factor in CD4-dependent T-cell activation of CD4. Defects in SPG21 are the cause of spastic paraplegia autosomal recessive type 21, also known as Mast syndrome, a neurodegenerative disorder characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Rate of progression and the severity of symptoms are quite variable. SPG21 is also associated with dementia and other central nervous system abnormalities.

참고자료
  • Zeitlmann L. et al., 2001, J Biol Chem. 276: 9123-32.
  • Simpson M. A. et al., 2003, Am J Hum Genet. 73: 1147-156.
  • Ota T. et al., 2004, Nat. Genet.36: 40-45.
  • Kedmi M. et al., 2007, Physiol Genomics. 28: 213-22.
  • Hanna M. C. et al., 2009, Neurogenetics.10: 217-28.
  • Size / Price
    Cat No: HG10522-NY
    정가:   (Save )
    가격:      [How to order]
    재고정보
     배송안내
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".